header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-160603-3
Genomic Feature: ihb134
Synonyms:
Affected Genomic Regions: irf1a (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-irf1a
Lab Of Origin: Yonghua Sun Lab
Location: Chr 13: 311539 - 311590 (GRCz11) (1) Details
Sequence:
Current Sources: China Zebrafish Resource Center (CZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 52 bp deleted in Exon 1 (1)
Transcript Consequence: Frameshift, Premature Stop (1)
FLANKING SEQUENCENo data available
NOTES
Comment Citation
deletion of GAGGAACAGATCCAGTCCGGCAGATACCCGGGAGTCCAGTGGCTGGACCAGG in exon 1 Zebrafish Nomenclature Committee
OTHER ihb134 PAGESNo links to external sites
GENOTYPESNo data available

CITATIONS  (2)