Genomic Feature

stl13

ID
ZDB-ALT-160202-2
Name
stl13
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Monk Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 7: 28676400 - 28676405 (GRCz11) (1) Details
Nucleotide change
CAGTTC/-
Variant Notes
TALENs were designed to cleave zebrafish gpr56 genomic sequences between exons  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
6 bp deleted (1)
Transcript Consequence
None
Protein Consequence
Amino Acid Deletion (1)
Sequences
Flanking Sequence
TGCAGACACAGACAAGACAAAAAACAACCTGGTGAGAATCACAATTATTTTTTTGACAGTGTAGTGAACTCCAGGTCACTGAATTCACACTTACCTGCGTTTGCAGAGCCAGTAGAAGAGCACCAAACAGCTCACCAAGGACACAGCACAGCCCACTGCGGTAATGAACGTCAGAGCCTTTAGATGGCGGACTGTACTCTTCTGCTCTACTTGCTGGAGCATCAAAGAGAAAGAGACAAGGTATGTATCATTTCATATTCATGCTGTAATCAATTACCGCACTGCCTGATTTGATATGCATATTTTCAATGATGAGGGAAGTACCTTTTATTCATAAAGTTTGGCTTTGCTACCAGCTATAAGTACAAAAACAAACATTTAATTTTCCTAATCTGCTAATCCTGCTACTCACCACAAGAATAGCAAAGTATGTGAGATGATTGCAGTGGCATTCTGTCTGTTCTTCGTTGATTTTAACTGTATCGCAGCCATCATCTTTC
CAGTTC/- ACTTCATTGTCTAGGGAGAAACACATTAGAAGAACAATTAGTAATTGTGCTGATGCCTAATGCTGACTGATGATGTGCATGAACATGACGACGGGAGCAGACCTTGTTTTGTATCCCATGAAACACATCTTCCTGAGCTGTCAGGCTGTGGAAGGAAACAGAAGAGGATTGGGATATCGGTTGTTAAAATAGAGACTGCATTCAGTCAGAAATGGTCTCAGAATCACAGGAAGCTTAGGGAAAGCTTTAAATGTCAGGCCCTGCCAGTGTGTTAATAGATTTGAATAAATAACCACCAAACCCCTTAATCTGTTTATTCAAAGCAGATTTCTCTATAAAAAGCAGCAGTCAGTAATACAATAAGAGTGAAAATTGTAAATACATAATTTAACTTGCTTAAAACAATAGCCAACAATACAGTAATTGAATCAAGTAATCAAATCGGATCACATTTTTTATCAAGAGTGTATATGTATGAAATAATTGGTGCTTTGACTATT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations