Genomic Feature

stl47

ID
ZDB-ALT-150721-14
Name
stl47
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Monk Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 20: 37408259 - 37408263 (GRCz11) (1) Details
Nucleotide change
TTGGA/AGT
Variant Notes
The gpr126 stl47 allele has a 5+3 insertion-deletion (indel) at Gln 68 that  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
3 bp inserted / 5 bp deleted (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
ATTTCATTTAGGCTTTTATTCATGTACATTTATTCATAGGCACTGGCGTTGATTTTAAAACTGTCAATTTTTCACTGGTATCTTACAAAAAAAATACATAAATAAATAAAAAAACAGACATAATGTGTTCAAACAGCTCCTGGGTTTAAGTATTTGCGCTCAGGTCTGATATAATCACTGCAGCCAGTTGTAATTCAACTAAAATCTCAACCAGGCTTGACATCTGTTTTCCTCTGGTTCTGTCTTTGTCTCTGTCGATGCACTAACCAAGCGGCTGTCTAAACGCATCTTCCTGTCGGCTGATTCCTCTCCTGTCCTCAGCCTCTGCTAAGACCTCCTATCCTTCACCAATGCAAGGTAAAGTGACATGTGCCCTGTTTGCTTGCAGTGGCACAGAGCTGCCAGAGTAGCACCAGCTGCAATGTGGTGCTCACCGACTCCCAGGGCTCTTTTACCTCCCCCTGCTATCCCAATGACTACCCACCCAGCCAGTCCTGCAA
TTGGA/AGT CCATACAGGCCCCGGCTGGCTTTATAGTACAGATCACCTTCCTCGATTTCGAGCTCGAGGAAGCACAAGGCTGCATCTATGACCGCGTTGTCGTCAAGACCGGCACCAGCGATGCCAAATTTTGCGGCTTAACGGCCAACGGACTAACTCTCAACTCCACTGGAAATGTGATGGAGGTTTTCTTTAACTCCGACTTTAGTGTCCAAAAGAAAGGCTTCCATATCAGTTACAAGCAAGGTATGTTTATGATTTGGTGCGCTTTAGCACAACATGTTTGTTTACCTATTCTTTTATTAATTGATTAATTTTTTATGTTTATGAATATTTTATTGACTAGTATTTAATAATTTATAGTTATAATTATTTTGTTATATTTATTCATTTATGCTTGTGCCCCTTTGTCATTCACGGGATGCCATTTAATTATGTTCTGCTTTCTGCTTTGGAATTGTAGCTGGGAGGTGGAAAAAAGATTTATAGTCATTCAAGAAGAGTTTTAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations