Genomic Feature

ihb40

ID
ZDB-ALT-141121-4
Name
ihb40
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 14: 5386340 - 5386356 (GRCz11) (1) Details
Nucleotide change
GTTTGTGCCCTCCGCGG/-
Variant Notes
176 bp to 192 bp of the wildtype lbx2 coding sequence, GTTTGTGCCCTCCGCGG, is  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
17 bp deleted from position 176 to 192 (1)
Transcript Consequence
None
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
GTAGTGTTTCTCTAATTGAACTTCACAAAAGCAATCAACAAGAACTCGTTAGCGGTTGCTTGCTGTTTTGAGGCTCCTTGAGACACTAAGGCTACACACGGTGAAGATCTTCATGGAGCAGCTCAGAGAACACCGCGTATGAGGACTAAAGTTCGGGTGCCTTCCTGCATGTGACGCCTGAAGCATGGTGCTTTTGGAGAGCCTCTTCAGAGTGAGGAACAACAACGATTTTTTGTAAAGAAAGGAACAGACAAGGCTTTTGTATGTATAAACAAGTTTGAGCGAGCTAGGTGACTTCTATTCGAAATAGTTTCTTGGGACTGAGATGACCTCCAGCTCTAAAGACATGAAAGCAGGATCCGTTTTGCAGTCCAGCGGCGAGGAGAGGCGGCGGGGTCCCTTGGACCAACTCCCACCTCCGGCCAACTCCAACAAGCCTCTCACCCCGTTCAGCATTGAGGATATCTTAAACAAGCCCTCCGTTAAGAAGTCCGTCGGTA
GTTTGTGCCCTCCGCGG/- GTGCTGGAGAAAGTAACCGGCTCGAGCGCATCTCGGAACGGGATCAGCGCCCCGTCCTCGCCGTTGTGCGCGCTGGAGGAGCTGGCGAGCAAAACATTTAAGGGTTTGGAAGTCAGCGTTATACAAGCAGCAGAAGGTAAAAAGTTCATAATTATTAACGAATTATCGCACTTGTTTTCAATGCACATATGGATTTTTAGTGACGCTTTTGGAAAATGCGAGCCATCATTTTATAAATGCATGTTTTACACGACATCGATTAAACAAAATAGCCTTTTACGAACACATACAAATGTATGTGTACTATTTCTTACTTGTTAGTCAAAAGGAGCATATTTATTTCGCTTTTAGGTAAAAAAGAAGATAACCTTAGCTTATTTATTAAATTCTTTGTCATAGCCTACATATTTTTAAACCGAATTTCAATAGCGGTTCGTAGAGTGTGATTGTCACTATTTCAGGAATTTCACCCACCGCCCTGAAAATCAAAACTTCTTAGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations