Genomic Feature

sa126

ID
ZDB-ALT-100506-17
Name
sa126
Synonyms
  • sa0126 (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Stemple Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
The truncation occurs within the loop of the basic helix-loop-helix DNA binding domain.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 2: 29711304 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
The truncation occurs within the loop of the basic helix-loop-helix DNA binding  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: at position 126 (1)
Sequences
Flanking Sequence
GATCGAAGAGTAGGCGATTGTTGTTACTGGGCAACACCAACACAGCACAAAAAATGGACACTGTGTTGGATCCATTCACAGGCTTAGACTCTTTCTCCTCCTCTTATTTCGACGACGATGACTTCTTTACGGACCACTCTTCGAGAGACCACTTGGACACAGACGACTTTCTGGACGAGGATGTCGATTTTCTTACCAACCAAATTCAAGAATATTACAAGGATAGTCGGATATCACAGGACGGAGATTATTGTGACGTTGGCAACTTCTCCTTTTCCTCGTCATCTTCGACTTTTTCTTACGGATGCGCGGACAGCACCTCAGAGCTGTCCCCTCACAGAGACGGAGGCTTACTGAAGAGGCGGAGGCGCATGAGGTCTGAAGTGGAGATGCAACAGTTGCGTCAAGCTGCCAACGTCCGGGAGCGACGGAGGATGCAGTCCATTAACGATGCTTTCGAGGGACTGCGATCTCACATCCCAACACTGCCATACGAGAAG
A/T GACTTTCAAAAGTTGACACTTTACGCCTAGCAATTGGCTACATAAACTTTCTTGCGGAACTGGTGCAGTCGGACATGCCAATTCGGAATCCACACAGTGACGCCTTAAACCAACCGAAAAAAGTCATCATTTGCCACCGAGGAACAAGTATGTATATCATTGCTTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATCTTGTTATTAAAACAACTCTTTCCTTTTTTTCTTTTCAGGATCCCCATCTCCAAATGACCCAGACTACGGGTTGCCTCCTCTCGCAGGACACTCTCTTTCATGGACTGATGAGAAGCAGTTAAAAGACCAGAATATCATTCGGACAGCGAAAGTCTGGACACCAGAGGACCCACGAAAGTTGCACTTGAAATCATCAATAAACAATATTGAGAATGAACCCCCCTTTAATTTCATTTCCTAAGGCAATGTTGCTATTAGTATCCCGTATATACACATTGTGTACA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations