Genomic Feature

s922

ID
ZDB-ALT-090121-2
Name
s922
Synonyms
  • akr (1)
  • akreas (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
ENU 
Lab of Origin
Stainier Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 2: 29711281 (GRCz11) (1) Details
Nucleotide change
T/A
Variant Notes
Transversion (T to A) predicted to cause an isoleucine 142-to-asparagine  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Ile>Asn at position 142 (1)
Sequences
Flanking Sequence
ACTCTTGAGCATCAAGAGGAAAAGATCGAAGAGTAGGCGATTGTTGTTACTGGGCAACACCAACACAGCACAAAAAATGGACACTGTGTTGGATCCATTCACAGGCTTAGACTCTTTCTCCTCCTCTTATTTCGACGACGATGACTTCTTTACGGACCACTCTTCGAGAGACCACTTGGACACAGACGACTTTCTGGACGAGGATGTCGATTTTCTTACCAACCAAATTCAAGAATATTACAAGGATAGTCGGATATCACAGGACGGAGATTATTGTGACGTTGGCAACTTCTCCTTTTCCTCGTCATCTTCGACTTTTTCTTACGGATGCGCGGACAGCACCTCAGAGCTGTCCCCTCACAGAGACGGAGGCTTACTGAAGAGGCGGAGGCGCATGAGGTCTGAAGTGGAGATGCAACAGTTGCGTCAAGCTGCCAACGTCCGGGAGCGACGGAGGATGCAGTCCATTAACGATGCTTTCGAGGGACTGCGATCTCACA
T/A CCCAACACTGCCATACGAGAAGAGACTTTCAAAAGTTGACACTTTACGCCTAGCAATTGGCTACATAAACTTTCTTGCGGAACTGGTGCAGTCGGACATGCCAATTCGGAATCCACACAGTGACGCCTTAAACCAACCGAAAAAAGTCATCATTTGCCACCGAGGAACAAGTATGTATATCATTGCTTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATCTTGTTATTAAAACAACTCTTTCCTTTTTTTCTTTTCAGGATCCCCATCTCCAAATGACCCAGACTACGGGTTGCCTCCTCTCGCAGGACACTCTCTTTCATGGACTGATGAGAAGCAGTTAAAAGACCAGAATATCATTCGGACAGCGAAAGTCTGGACACCAGAGGACCCACGAAAGTTGCACTTGAAATCATCAATAAACAATATTGAGAATGAACCCCCCTTTAATTTCATTTCCTAAGGCAATGTTGCTATTAGTAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations