ZFIN ID: ZDB-ALT-080827-1
Genomic Feature: wpr2e2
Synonyms: picasso (1)
Affected Genomic Regions: erbb3b (1)
Type: Point Mutation (1)
Protocol: ENU 
Lab Of Origin: Parichy Lab
Location: Chr 23: 25255795 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: C>T at position 433 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Gln>Stop at position 145 (1)
FLANKING SEQUENCE (GENOMIC)
CTGAATGGGCTCTATCGCTGTCTCTCCACTCTCCCTATTGCTGGTGTGTAGTGCACTGGCGCCGTTGTCCTGTGGCTGCCTTCACATTATCCAAGTGGATGCTGCACACTGGTGCTGGTGTGGAGAGACCCCTCCCTCATGATTGTGAAGTGCTTTGGGTGTATGGCCATACACAATAAATGCACTATATAAATAGATATTACTTACTTAGTAATATCTCCTACTTTGGAGACATTTCAGAATTAAAACACTTGTATGTTGTGTTTTTATATACAGCACTTTGGTTACCATTGTGGTTGTTTAAAAATGCTTCAAAGATCAAATTAAGTAATTTAGGTAAAATAAATTGTACATTTTTGAACATATATAAATGTTAGACTATACTTTAGACAAGCATAAGTACAAACCGGTGTAGTTCCCCCTGTGCGCAATTTGTTTTCTGCATTAAATAAATCAGATTTATTTTCACTGTGTCTGCAGAGATCTTGGAAGGTGGAGTA
C/T
AGATTGTCCACAACAGGAACCTCAGCTATGCTCCATTGATCAACTGGCAGGACATTGTCAGAGACGGTGACGCTCGCATCCAGATCCAGGACAATGGAGGAAGAGGTTTGTGTTCACATCTTGATTGTATGAGTGTGAGAGATAAATGTGTGTCAGGAAATTATGTTTTATATTCTGAAAAAAACCCACACAAAATAAAGATGTTCTGAGCTACCATGAAGATATCATCAAAAAAAATGCACTTCAGTTTAAGTTTTTTTTTCCTCTATAAAAAATCGCAAATTTTATATAGAAAACAAATTTTGAGAGGATCACTTGCTTATGATTGACTATGGCGGGCCCCCCATTAGCTATCACATGATACACCAATCAGATGATTACTAAAAAGAGCCAGATCTCCTTGCCTTAGCCCACTTCATATTGAAGAATCCCCCCATCCTCCCCTACTCCTTCCTCTCTTTTTTAACTAAATAGGGGGTAGCTCTCAAGACCTACCTCAG
OTHER wpr2e2 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous erbb3bwpr2e2/wpr2e2 erbb3b ♀+/- ♂+/-
Heterozygous erbb3bwpr2e2/+ erbb3b ♀+/- ♂+/-
Complex erbb3bwpr2e2/+ ; w61Tg erbb3b
erbb3bwpr2e2/wpr2e2; hzm1Et; io006Tg erbb3b

CITATIONS  (7)