ZFIN ID: ZDB-ALT-070117-14
Genomic Feature: gl11
Synonyms: gl12 (1), mne (1)
Affected Genomic Regions: zbtb11
Type: Point Mutation (1)
Protocol: ENU 
Lab Of Origin: Lieschke Laboratory
Location: Chr 6: 29158290 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Cys>Ser at position 116 (1)
FLANKING SEQUENCE (GENOMIC)
CGTTGGGTTTTGCCAAAGTAGAGTCATTTGCATATTCATACGGGGGAGGAGGCAGGGAGGGGTTTTGTGCTCGTGCATGTTGCGCTCAGTCTCACGTTCATTCAGATGTACAAAAGAATATGCGTGAGATTCGGCGTACGCAGTGTTTCATACATCTGAATTGTTTTCTGCGTACGCACATTTACAGCTTTGTGCGTACGCAATGTTTTAGTATGATTTCCACGCAAGTCTTTGTACATGAGGCCCCAGGTGTTTTATAGTAAGTAAAGCCCCTATTTTAAGGAATTTCTCACATAAATAACATAGTGTACTTACAAAAACCAGTTCATGTTTATCAACTGTAGTGGACTGCTCCTCTTCCAGATCCTCATGTATTTCATCATCCTCTTCCTCACTGGCACAGGCAGAGGAGATCTTCTGTCGAACTTGTCGGGCAGTTTGCTTTGGGGCATCTTCAGTATTGTTTCTCCCCTTCTCCTGCTTGGTTTGGCAATGAATGC
A/T
TTCCTTGATGCAGTCCTTCACTTGCTTCAGCACACCTGTGATATGGCAGACTAGATTAATGCAACATGTACTGATGATAGTAGTAGATCACTAGATAATAGACTTTCTATAGTTTTACATTAAATAGAGCTATAGGGGAAAACCAAGAGACCACTTGGAAATTTTAGTTTCTCTGCATTTATTTAGAATAAGTTTTAATACAATTTTTAACATTTGCCTCACTTTAAAGGTCTTCCACATTAAAAATAAGTAAATAAATAAATAATAATAAAAATAGTAATTTGGAGATTTTTTACAAAGACAGTCAGATGACAACCGCTTTCTTTTGTTGTCATTTAAAATTAGAAGAAAAAAATAAATTCTTAAAAGTTAAAATATTGTGTTGTCTAAAAATGTATGTAAACATGTCTGTGGGGAAAAAAACATGACACATTTAGTTATTTTTTGCATACAAATGCTGTAATTGTCAAAAAATGTTGTACTGAACACTAGTTTTATTC
(1)
OTHER gl11 PAGES No links to external sites

CITATIONS  (4)