Genomic Feature

s231

ID
ZDB-ALT-060628-4
Name
s231
Synonyms
  • hu231 (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Jin Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 9: 34416576 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
This allele has a C->T tranversion at nucleotide 3600 in the med14 gene,  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T at position 3600 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Gln>Stop (1)
Sequences
Flanking Sequence
TTCTTTCAGCATAAACATTCCTTGCAGTAACTAATTTTAGTCATTGTGTATAGGTTCACAGGCGATGCCTCCACCTCGTAAACTGCCACAGCGGTCTTGGGCAGCCTCTATTCCCACCATCCTCACCCACAGCAAGCTACATGTGTTGCTTCTGCCTTCACCCATGCCATGCCCGGTCCCAGGGCTGGCAGGCAGCTACCTGTGCTCACCTCTGGAGCGCTTCCTGGGCTCAGTCATCATGAGACGACACCTGCAGAGAATCATCCAATTAGAACCCAACGTGAGTCAGAAGCTGTAAACATTTCGTATGGTTACTTACCTTCATATACCTGTATCACACTTTGACTACCTTCTATTCACAGCTCACTATTGTGAACTCAAATGAACCAGGCGTCATCATGTTTAAAACAGAAGTGCTTAAATGCAGAGTGGCTCTCAACCCTAAATCCTACCAGACTCTCCAGCTGAAAGTCACACCAGAAAACACGGGACCCTGGTCA
C/T AGGAGGAGCTGCAGGTCTTGGAGAAGTTCTTTGAGACCAGGGTAGGAAATCAGCTCAACAACTGTCATGCCTTTTGTTCAGTTTGTGTTTTGGAAATTTGTAGTAGATAGATTTGTATTCTGTTTAAGAGCCCTTATTGGTCCAATGCTTCACATACAGTGAAGTTCTTTTTCAATCTTTACCTAAACAGTGGTATACTGTTATCAAATATTGTGACTGTACCCAGCTGAATATATAAATGTCTGCTGCATGCTTTCCTCTCAGCAACAAAAACACACAAGAAAAATGACATTGCTGAGAAAACAGAAGTTTAGCATCATCTAATCATAGAGTTATGGATACATGTTTGGACTCAATTATGCTTGCCTTGTTTACTGTTGGTTGCTAATTTACCAATACTACAGCTGTGTGTTCTAACAACCTGATGGAAATGTTTATTCGCATTTGAGATTTTTTTTTGTAAACTTTTTTTTTTTGTAAGATTTTTTCACGTTGGGATG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations