Genomic Feature

zdf10

ID
ZDB-ALT-060519-4
Name
zdf10
Synonyms
  • sym1 (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
ENU 
Lab of Origin
A. Thomas Look Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 6: 32093063 (GRCz11) (1) Details
Nucleotide change
C/-
Variant Notes
a guanine (537) deletion results in a frame shift leading to a premature stop  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
1 bp deleted at position 537 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
CTGAGGATGGGCGCGATGGCAGCTGATGTCCGGGTTAAGGACAGGGACTGAGCGCTCAGTAAGGCGGACTGCACCGTCACGGGTGGCCGCAGGAAAGTCTGTGCGCTCGTAGAGCTGCTGGAGACCCCGATGATGTTTTCTATGCTGAATGATGGTCGACTGGACGGCTCGGATTTGATAATCGACGCGGTGCTCAGGCTATTTAGCTGTAACTGGAGACTTGGACTTAGCTGAGAGCTGAAAGCTTTTCTGTTCAGTTCGGCGGAGGGTAAGAGAGGCACCGCCGGAGGGAGCATCGGACCCACAGGGGGAATGTACGGGTACTGCAGAGCGGCAGGGTGCGTGTATGCAGCCGGGTGAATTCCATAATGACGTCCATATGGATTCCCAATGCCGTATGCCCCAAAACTCTGCATCATGAGGGCGGTCTGGTCCCTGAGAATGTCCGGCTGATGCCTCTTGAAGCGTTTTCTCCTCCTCAGAAAGCTACCGTTGTCGAA
C/- ATATCTTCCGACTGGGGGTCGAGGGTCCAGTAGTTGCCTTTGCCCGGGTTGCCCGGTTCCCGTGGGATCTTGACGAAGCAGTCGTTGAGCGACAAGTTATGGCGAATGGAGTTTTGCCAGGCCGGAAACTTCTCCCGGTAGTATGGGAAGCGGTTGCTGATGAACTCGCAGATTCCACTGAGCGTCAACTTCTTCTGCGGGCTCTGGAGGATGGCCATGGTGATGAGGGCGATGTACGAGTAGGGCGGCTTTACCAGGCTGCTCTTGGGCTTGTTTTGCATGGGACCGGTGGAGCTCTCCTGAGCATCCCCCTTGGTCTCTCCGTCAGCGTTGCTCTCGCAGGGACTGTCGCTGCGCTCCTTCACCTCGATCTCCTCCACCTCATCTCCCCGGTCCTGCATGCACTGGCTTTCGCAGTCACTGTCCTGCTCCATCCCCTCGTCACCCTCCCCGACCACGTCGATATCCACATCGTCAGCTGTGAGCACGGTCTGACCGGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
zdf10.pdf
Citations