Genomic Feature

s552

ID
ZDB-ALT-040720-42
Name
s552
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
Baier Lab
Current Source
Other Pages
Note
A T-to-G mutation results in the amino acid change M1208R.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 6: 10260854 (GRCz11) (1) Details
Nucleotide change
A/C
Variant Notes
A T-to-G mutation results in the amino acid change M1208R.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>G (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Met>Arg at position 1208 (1)
Sequences
Flanking Sequence
ATTTTTGATGTTTTACAATGTGGTCAGCCTGCTGGTTTTCATCATCACATGATCTCTTATAATAAAATCGCATAAGTTTTCATGGGCATTTTCAAAATATCCAAAATGCGTATAAACATAGGTAGATGGAAACATAGCTAGTGACTTGCCTAATTACCCTATCTTGCCTAATTAACCCTGTTAGACTTAAAATGTCACTTTAAGCTGAACACGAGTATCTTGAGTAAAAGTAAAATATGATGTACTGTCATAATGGCAGAGATAAAAGAAATCAATTAGAAATTAGGTCTTAAAACTGTTATGATTAGAAATGTGTTGGAAAAAAAATCTCTCTGTTAGACAGAAATTGGGGGGAACAATAATAATTCTGACATCAACTGTACACATCAACACATTTCAACAGCTAGTAACAGAGATCGGGCCGGTTGTGAGTGGGTGGTTGTATTGTGTTTGTTATGGTTGTGTGGGTGCTCACCAGTGCTCCGCTGCTGAGTAAAATC
A/C TGAAGATGATGAAGGACTCAAACCAGTTGTGCTCTACTATGATAAAGCAGGTTTTCCTGAGAATCCACCAACTCTTCCATTTTCCCTTCTCCACATCGACCTGACAGCACTGAAACCTCATCACACAGCCTGAGCAAAAGAAACACAGAAACAAGTCCCTTAATGTGAACAGACAGTAGAAAAATTGAGCTCAGTGGAAAGTCTACTCCTTAAAGTAGTCCCAGAAATGTAATACTAGAAGTCTTGCTGTGGCACTACATATGACATAAAGGGGCCAGTTTGTACATTTTGTTAGTCAAACTATGCACAACATTGCATTATTGCAATATTTTCCCAAAAAATATCTTTTACATCTCTGATATACATACAATACACTGACAGAATCATAATTATATCATTTTACATTCATTTGGTGTAGTAAAAGTTCAATCATTTTTAAATAGTTACAATTTTTGAGGTCTTGCATTTTTTTAAACTAAGAGCAAATCTGACGATGAGCC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations