Transcript

arr3b-203

ID
ZDB-TSCRIPT-160112-829
Name
arr3b-203
Previous Names
  • arr3b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062861 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062861|OTTDARG00000042758| arr3b|OTTDARP00000049148 arr3b-002 LG_ AL590151.8 Danio rerio protein_coding KNOWN, 728 bp
GTACATAATTAAGAGCATAATTGCTACCTCAAATGTTGCT
ACTGCCCTCTGTTGGCAAAATTTTTAACCATTTCCTTTCT
CATTTCAGAAACGTTAGCAGCTAACTTTTCAACACCATGA
CAAAGGTTTACAAGAAGACTAGTGGCAATGGATCGCTTTG
CCTTTATTTGGGGAGGAGAGACTTTGTGGACCACGTGGAA
AGCGTTGATTCAGTTGATGGTGTACTTAAGATTGATCCTT
CAGGTCTTAATGGAAGGAAAGTGTGGGTACAGCTGGCATG
TGCCTTTCGCTATGGACGAGAGGATCTGGATGTGATTGGA
GTTTCATTCAGGAAAGATATCTGGATAAAGCGCATTCAGA
TGTACCCGTTTGAGGGAACCAAGCCCCCAAACACACCAAT
GCAGGAGGCGCTATTGAAGAAAGCTGGAGACCAAGGACAT
CCATTCACTTTTGATATTCCTGTACATCTTCCATGCTCAG
TGTCCCTTCAGCCAGCACCAGAGGATGCCGGAAAGCCTTG
CGGGGTTGACTATGAAGTCAAAGCCTATATTGCCAATGAA
GAAGACAACATAGATGAGAAAGTCGAGAAAAAGGACACTT
GCCGACTAATAATCCGTAAAATCCAGTATGCACCAGCTGA
ACTGGCTGCCGGACCCAAAGCCGATATCAACAAACAGTTT
ATCACTGCAGACAAACCAATTCACATGGAAGTCTCCATGG
AGAAAGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations