Transcript

arr3b-201

ID
ZDB-TSCRIPT-141209-1069
Name
arr3b-201
Previous Names
  • arr3b-001
  • rp71-46j2.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061786 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061786|OTTDARG00000042758|ZDB-GENE-030616-74 arr3b|OTTDARP00000048318 arr3b-001 LG_ AL590151.8 Danio rerio protein_coding KNOWN, 1755 bp
AAAGGCGGACAAGGCAATCTGGGAAACAGACTAAAGCAGC
AGAACTTGAAAAGCTCAGAACTTGAACTCCTAAAACTCTG
ACACAGAAACGTTAGCAGCTAACTTTTCAACACCATGACA
AAGGTTTACAAGAAGACTAGTGGCAATGGATCGCTTTGCC
TTTATTTGGGGAGGAGAGACTTTGTGGACCACGTGGAAAG
CGTTGATTCAGTTGATGGTGTACTTAAGATTGATCCTTCA
GGTCTTAATGGAAGGAAAGTGTGGGTACAGCTGGCATGTG
CCTTTCGCTATGGACGAGAGGATCTGGATGTGATTGGAGT
TTCATTCAGGAAAGATATCTGGATAAAGCGCATTCAGATG
TACCCGTTTGAGGGAACCAAGCCCCCAAACACACCAATGC
AGGAGGCGCTATTGAAGAAAGCTGGAGACCAAGGACATCC
ATTCACTTTTGATATTCCTGTACATCTTCCATGCTCAGTG
TCCCTTCAGCCAGCACCAGAGGATGCCGGAAAGCCTTGCG
GGGTTGACTATGAAGTCAAAGCCTATATTGCCAATGAAGA
AGACAACATAGATGAGAAAGTCGAGAAAAAGGACACTTGC
CGACTAATAATCCGTAAAATCCAGTATGCACCAGCTGAAC
TGGCTGCCGGACCCAAAGCCGATATCAACAAACAGTTTAT
CACTGCAGACAAACCAATTCACATGGAAGTCTCCATGGAG
AAAGAGCTCTACTATCACGGAGATCCCATTCCAATCAAAG
TGAAAGTGAACAATGAGACAAGTAAAGTAGTGAAGAAAAT
CAAGATCAATATTTTCCAAATTACAGATGTAGTGATTTAT
GCAGCGGACAAATACCACAAATGTGTACTGAATGAAGAAT
TTGGGGACCAAATTAATGCAAACTCCACCTTTGAGAAGGA
ATATTCAGTCACTCCATTACTGGTCAATAACAAAGAGAAA
CGTGGTCTTGCATTGGATGGCAGACTTAAAGATGAAGACA
CCAACTTGGCTTCTTCAACACTTCTGATTCCCGACATGGA
TAAGCAAATGCAAGGCGTTGTTGTTTCCTACAAAATTAAG
GTCATTCTCATGATGGGAGGTGGACTCTTGGGAAGCCTCA
CATCAAGTGATGTTACAGCTGAACTCCCCCTTGTTCTGAT
GTCACCCAAACCAGCAGAGATATCTGACATCAACCTCGAA
TAGATTCTACAGCCAGTGAGGAGCAAGTCAGACCGAGATG
CTCAGGAACAGATTCAGATACCAAACAACCTCATTTCACA
TATGATAGACACTTCCTTCTTGCAAAAATCTGTGTAAAAG
TATTAGCTATATAAGATGAAACATCGGCCCAAGGTCTTTA
ATTTGTGTTGAGACAACATGAAAAAACTTACAAATTGAAT
TGGATTGAACATGAAACAATTGAGTTATCCCAAAACACTC
AAGAATTGTGTTGTTTCAGCTCATTTTTAATAAGTAGTTT
AAACAAACAGCAACAAACTGTTTTTTTAAGTGTTGTGTAC
TAAAATGAACTCAATGACACTGAACTTAAGCATTGTTCTG
ATGCTTTTACAATGTCATGTTTATCTCTTCTGCCTTTATC
ATGTGTAACAGTGTTTTAGTTTCTTTTTGTATGTAAATTA
GTGTTGTAAAATATGAGGGAGCAATGAATGATTTACTTGA
ATTATTTTATTTGTTCTTTTTTTCTGGATGTGCTGATGGT
GGACATGAATAAACATTTGACTGTTATTTAGACCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations