Transcript

arr3b-003

ID
ZDB-TSCRIPT-160112-512
Name
arr3b-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062860 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062860|OTTDARG00000042758| arr3b|no_translation arr3b-003 LG_ AL590151.8 Danio rerio protein_coding KNOWN, 1029 bp
AGACTAAAGCAGCAGAACTTGAAAAGCTCAGAACTTGAAC
TCCTAAAACTCTGACACAGAAACGTTAGCAGCTAACTTTT
CAACACCATGACAAAGGTTTACAAGAAGACTAGTGGCAAT
GGATCGCTTTGCCTTTATTTGGGGAGGAGAGACTTTGTGG
ACCACGTGGAAAGCGTTGATTCAGTTGATGGTGTACTTAA
GATTGATCCTTCAGGTCTTAATGGAAGGAAAGTGTGGGTA
CAGCTGGCATGTGCCTTTCGCTATGGACGAGAGGATCTGG
ATGTGATTGGAGTTTCATTCAGGAAAGATATCTGGATAAA
GCGCATTCAGATGTACCCGTTTGAGGGAACCAAGCCCCCA
AACACACCAATGCAGGAGGCGCTATTGAAGAAAGCTGGAG
ACCAAGGACATCCATTCACTTTTGATATTCCTGTACATCT
TCCATGCTCAGTGTCCCTTCAGCCAGCACCAGAGGATGCC
GGAAAGCCTTGCGGGGTTGACTATGAAGTCAAAGCCTATA
TTGCCAATGAAGAAGACAACATAGATGAGAAAGTCGAGAA
AAAGTATGTACTGCTCCATTGAAAGGGGTCATGAACTGAA
AAATCAAAACATGAAAGAGGGATTGTACTATTGACCTTTT
TCTACAATGCTGAAGTGCGCTTGTATTTTTTTTTTTCGAT
TGTTTTTGAACTTTTGTTGGCGTTGATTCAGTTGCCTATG
GGAGAAATGACTAGCACTAATAAATAGCAGAAAACTAGAA
ATCTAAAACTACTCTACAAACAAGTGTGTTCATTACTTTA
TATATAAAGTAGAATAATAAATTAAGAAAATGTCAGTTTG
CAACATCAAGCAGCATTATGAGTTTTTTTTTTTTTGTCTA
AAAATCAATGAAAGTAAAGGAGACCGGTCTAAAATCAAAA
AGATTTCAATGGTTGTGTCCGCTTATACGTCAAGAATAAG
GTCTATAAAATACATCAAGACCTCAAAACTTACTTGTTAG
TCTAAAACAGCTTATAAAACCAAACTGCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations