Transcript

nrg2b-203

ID
ZDB-TSCRIPT-141209-953
Name
nrg2b-203
Previous Names
  • nrg2b-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061421 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061421|OTTDARG00000041990|ZDB-GENE-090205-2 nrg2b|OTTDARP00000047799 nrg2b-004 LG_none BX005008.12,BX323592.8,CR407701.6 Danio rerio protein_coding KNOWN, 529 bp
GCATCAGCTCCAAAGGTGAAGCCCATGGATTCTCAGTGGC
TCCAGGAAGGTAAAAAGTTGACACTGAAGTGTGAAGCTGT
GGGCAACCCGAGCCCCTCCTTCAACTGGTACAAAGATGGC
AGCCAGCTTCGCCAAAAGAAAACCGTCAAAATCAAAACCA
ACAAGAAAAACTCAAAGCTTCACATTAGCAAAGTCAGACT
GGAGGATTCTGGGAACTACACCTGTGTGGTGGAGAACTCG
CTGGGCAGAGAAAACGCCACCAGCTTCGTCAGCGTCCAAA
GCATAACCACCACATTGTCTCCGGGCTCAAGTCATGCCAG
GAAGTGCAATGAAACTGAGAAGACATACTGCATCAACGGT
GGAGACTGTTATTTCATACATGGTATAAATCAGCTGTCCT
GCAAGTGTCCAAATGACTATACCGGCGAACGCTGTCAAAC
CTCCGTTATGGCCGGTTTCTACAAGGCTGAGGAGCTGTAC
CAAAAACGAGTGCTGACGATAACTGGCATCTGCGTGGCTC
TGCTGGTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations