Transcript

nrg2b-204

ID
ZDB-TSCRIPT-141209-3396
Name
nrg2b-204
Previous Names
  • nrg2b-003
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061420 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061420|OTTDARG00000041990|ZDB-GENE-090205-2 nrg2b|OTTDARP00000047798 nrg2b-003 LG_none BX005008.12,BX323592.8,CR407701.6 Danio rerio protein_coding KNOWN, 798 bp
TTTAGCATCAGCTCCAAAGGTGAAGCCCATGGATTCTCAG
TGGCTCCAGGAAGGTAAAAAGTTGACACTGAAGTGTGAAG
CTGTGGGCAACCCGAGCCCCTCCTTCAACTGGTACAAAGA
TGGCAGCCAGCTTCGCCAAAAGAAAACCGTCAAAATCAAA
ACCAACAAGAAAAACTCAAAGCTTCACATTAGCAAAGTCA
GACTGGAGGATTCTGGGAACTACACCTGTGTGGTGGAGAA
CTCGCTGGGCAGAGAAAACGCCACCAGCTTCGTCAGCGTC
CAAAGCATAACCACCACATTGTCTCCGGGCTCAAGTCATG
CCAGGAAGTGCAATGAAACTGAGAAGACATACTGCATCAA
CGGTGGAGACTGTTATTTCATACATGGTATAAATCAGCTG
TCCTGCAAAGGCTGAGGAGCTGTACCAAAAACGAGTGCTG
ACGATAACTGGCATCTGCGTGGCTCTGCTGGTGGTTGGCA
TCGTGTGCGTGGTGGCATACTGCAAAACCAAGAAACAAAG
AAAGAAGATGCATAACCATCTGCACCAGAACATGTGTGCG
GAGCATCCAAACCGCATGCTGGCCAACGGACCCAACCATC
CTGGCCCCGGGCCTGAGGAGATCCCCATGGTGGATTATAT
ATCTAAGAATGTCCCGGCAACTGAACGAGTAGTACGACAT
GGAACTGAAACATCAGGCAATTTCTCGGGCAGCCGAATGT
CGTCACGGTCCCACCACACCTCCACAGCGTCTCACACTTC
CAGCCACCGGCACGAGGAGCGCACATGGAGTATGGAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations