Transcript

si:ch211-156l18.6-202

ID
ZDB-TSCRIPT-141209-779
Name
si:ch211-156l18.6-202
Previous Names
  • ch211-156l18.6-002
  • si:ch211-156l18.6-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060832 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060832|OTTDARG00000042167|ZDB-GENE-141222-85 si:ch211-156l18.6|OTTDARP00000047011 CH211-156L18.6-002 LG_ BX469912.6 Danio rerio protein_coding NOVEL, 1037 bp
CAGATTATTGATATTATTGATTGTTGGATACATCGATTGA
TCGTCTGCTTCTCCCTTCATTCAGGTTTGACCCTTGTTAT
CACACTGTGTTTTGTGTTCAGTATGTCTTGTGTTCATTAC
AGGTTTCAGAGTCGACTCACCTACGACTCGCTCCAGTTTG
AGGGCCTCAACATCACTGTGGGAGAGCTGAAGCGGCAGAT
CATGAGGCGCGAGAGGCTGAAGTTCTGCCAGCTGAAGATC
AGCAAAGCCCAAACTGATGAAGAATACACAGATGATGATG
CTCTCATCCCCAAAAACACATCTGTCATCATCAGACGGGT
CCCTGCGGCTGGACTGAAGTCCTCCAACAGAAGATTTGTT
GGCCATCAAGCTGGACCATCAGCTAAATCTTCTCAAACAG
GTGATTCTTCACTCCTCTCACTGGAGCAGCTGTTGAAGAC
TGAGAATCTGGCTGAGGCAAAGGCATCAGAGGAGGACAAG
CTGAAAGCGGCGATGTACCAGTCCAGTCTGTGCTACTACT
CCAGCAGTGAGGCCATGACACTGCTTGGGCTTCTTCCACC
CAACTATGTCTGCTTTCACTGTGGGATCCCAGGACACCAC
ATTAGGCACTGCCCCTCTAAAGGGGGCAGCAGCTCTGCTC
CACACAAGCGCATCCGGAGGAGCACAGGGATTCCCCGCAG
CTTCCTGTTGGAGGTGGACGACCCAAACCGAAAGGGAGTC
ATGATGGACGGCAGCGGCAAATACGTCATTCCCATCATAG
ACGCTGAGGCCTATGCTGCTGAGAAGAAAAAGAGGCCGTC
CTTCTCCTGCCAGGCCAAGCCGCTGCCCTTCTCTTCCTCA
GCTGGTGCAGCATCTTCAGTCCAGGACGCCAGAGGGAAAC
GTTCCCGCTCCCCATCTCCACCAGAGACGCACGGAGACCA
GAAGAGACCACGTCACTGAGAGACCTTCACCCAAGAGACC
TGGAGCCGACGTGAGCACAGTGTATATATTGTACATAGTT
TATGAATAAAACTGAATAAAGATTATAGCAGCATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations