Transcript

si:ch211-156l18.6-201

ID
ZDB-TSCRIPT-141209-2002
Name
si:ch211-156l18.6-201
Previous Names
  • ch211-156l18.6-001
  • si:ch211-156l18.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060830 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060830|OTTDARG00000042167|ZDB-GENE-141222-85 si:ch211-156l18.6|OTTDARP00000047010 CH211-156L18.6-001 LG_ BX469912.6 Danio rerio protein_coding NOVEL, 1011 bp
TTTTTGTGTTGTTTTGAACTTCGCTCTGTCATTGGCATCT
GATCTCGGCGTCCTTCCTGGCAACTGATTCCCAGATTATT
GATATTATTGATTGTTGGATACATCGATTGATCGTCTGCT
TCTCCCTTCATTCAGGTTTGACCCTTGTTATCACACTGTG
TTTTGTGTTCAGTATGTCTTGTGTTCATTACAGGTTTCAG
AGTCGACTCACCTACGACTCGCTCCAGTTTGAGGGCCTCA
ACATCACTGTGGGAGAGCTGAAGCGGCAGATCATGAGGCG
CGAGAGGCTGAAGTTCTGCCAGCTGAAGATCAGCAAAGCC
CAAACTGATGAAGAATACACAGATGATGATGCTCTCATCC
CCAAAAACACATCTGTCATCATCAGACGGGTCCCTGCGGC
TGGACTGAAGTCCTCCAACAGAAGATTTGTTGGCCATCAA
GCTGGACCATCAGCTAAATCTTCTCAAACAGGTGATTCTT
CACTCCTCTCACTGGAGCAGCTGTTGAAGACTGAGAATCT
GGCTGAGGCAAAGGCATCAGAGGAGGACAAGCTGAAAGCG
GCGATGTACCAGTCCAGTCTGTGCTACTACTCCAGCAGGG
CAGCAGCTCTGCTCCACACAAGCGCATCCGGAGGAGCACA
GGGATTCCCCGCAGCTTCCTGTTGGAGGTGGACGACCCAA
ACCGAAAGGGAGTCATGATGGACGGCAGCGGCAAATACGT
CATTCCCATCATAGACGCTGAGGCCTATGCTGCTGAGAAG
AAAAAGAGGCCGTCCTTCTCCTGCCAGGCCAAGCCGCTGC
CCTTCTCTTCCTCAGCTGGTGCAGCATCTTCAGTCCAGGA
CGCCAGAGGGAAACGTTCCCGCTCCCCATCTCCACCAGAG
ACGCACGGAGACCAGAAGAGACCACGTCACTGAGAGACCT
TCACCCAAGAGACCTGGAGCCGACGTGAGCACAGTGTATA
TATTGTACATAGTTTATGAATAAAACTGAATAAAGATTAT
AGCAGCATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations