Transcript

si:ch211-156l18.6-003

ID
ZDB-TSCRIPT-141209-3222
Name
si:ch211-156l18.6-003
Previous Names
  • ch211-156l18.6-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060831 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060831|OTTDARG00000042167|ZDB-GENE-141222-85 si:ch211-156l18.6|no_translation CH211-156L18.6-003 LG_ BX469912.6 Danio rerio protein_coding NOVEL, 1254 bp
GGCATCTGATCTCGGCGTCCTTCCTGGCAACTGATTCCCA
GATTATTGATATTATTGATTGTTGGATACATCGATTGATC
GTCTGCTTCTCCCTTCATTCAGGTTTGACCCTTGTTATCA
CACTGTGTTTTGTGTTCAGTATGTCTTGTGTTCATTACAG
GTTTCAGAGTCGACTCACCTACGACTCGCTCCAGTTTGAG
GGCCTCAACATCACTGTGGGAGAGCTGAAGCGGCAGATCA
TGAGGCGCGAGAGGCTGAAGTTCTGCCAGCTGAAGATCAG
CAAAGCCCAAACTGATGAAGAATACACAGATGATGATGCT
CTCATCCCCAAAAACACATCTGTCATCATCAGACGGGTCC
CTGCGGCTGGACTGAAGTCCTCCAACAGAAGATTTGTTGG
CCATCAAGCTGGACCATCAGCTAAATCTTCTCAAACAGGT
GATTCTTCACTCCTCTCACTGGAGCAGCTGTTGAAGACTG
AGAATCTGGCTGAGGCAAAGGCATCAGAGGAGGACAAGCT
GAAAGCGGCGATGTACCAGTCCAGTCTGTGCTACTACTCC
AGCAGGTGAGCGTTCAGACACTGACAGGTTTGGTTTGTGA
GAAATGTTAGAGCTGATTCTCATGGTTCTGATGTTCATCA
GTGAGGCCATGACACTGCTTGGGCTTCTTCCACCCAACTA
TGTCTGCTTTCACTGTGGGATCCCAGGACACCACATTAGG
CACTGCCCCTCTAAAGGGGTAACTGGGTTTTCTAAGCTTA
TGGTTGCTGTGAACTTGAGCTCTTGTCTCCATCAGTCAGA
TTGTTTGCTCTGTCGTTTGACTGTCACTCATGAATTCACA
GGGCAGCAGCTCTGCTCCACACAAGCGCATCCGGAGGAGC
ACAGGGATTCCCCGCAGCTTCCTGTTGGAGGTGGACGACC
CAAACCGAAAGGGAGTCATGATGGACGGCAGCGGCAAATA
CGTCATTCCCATCATAGACGCTGAGGCCTATGCTGCTGAG
AAGAAAAAGAGGCCGTCCTTCTCCTGCCAGGCCAAGCCGC
TGCCCTTCTCTTCCTCAGCTGGTGCAGCATCTTCAGTCCA
GGACGCCAGAGGGAAACGTTCCCGCTCCCCATCTCCACCA
GAGACGCACGGAGACCAGAAGAGACCACGTCACTGAGAGA
CCTTCACCCAAGAGACCTGGAGCCGACGTGAGCACAGTGT
ATATATTGTACATAGTTTATGAATAAAACTGAATAAAGAT
TATAGCAGCATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations