Transcript

rrm2-213

ID
ZDB-TSCRIPT-141209-433
Name
rrm2-213
Previous Names
  • ch73-187m15.5-002
  • ottdart00000053994
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053994 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053994|OTTDARG00000037730|ZDB-GENE-990415-25 rrm2|OTTDARP00000042425 CH73-187M15.5-002 LG_ CU695215.3 Danio rerio protein_coding NOVEL, 836 bp
GTTTTTGTTATGAAAAACAAAGGATCTATACTCGTTGACT
AGTTGTAAAATACGTTTTCCGCTTAATTTGAGTTGTTTTT
TTTATATGTCGAGTTTAAAAATAATCAACAAAGTCCGTTG
GAGTTCGTGTTAACGGTTTAGTTGTGGTGAAGAACTGGCT
AAACAGCTGAGAGATTATTGTGGTGTAAAGTTTGATCGGC
AATAAAATACTGACACCTCTTTGATGACAGTAAATGTTAT
ATTAATGATGTGGTATTAGTGATATTATTGATGTCCAATA
TACGTTAATCTTCGTGCTGAAGGACAGGAGAAACGACAAC
AAGACATTTACCTCTGTCATACGGAGGATTTGATGAAGCT
TTACAATGTCGTCCACTCGCTCTCCCCTGAAAACCAAGAA
TGAAAACACAATCTCTACTAAAATGAATAACATGTCCTTT
GTGGACAAAGAAAACACGCCACCCAGTTTGAGCTCCACCA
GAATCCTGGCGTCCAAAACGGCGCGCAAAATCTTTGATGA
ATCAGAGGGGCAGTCGAAAGCAAAGAAAGGAGCAGTGGAG
GAGGAGCCTCTTCTGAAGGAGAACCCCCATCGCTTTGTCA
TTTTCCCAATTCAGTATCATGACATCTGGCAGATGTACAA
GAAGGCAGAGGCCTCTTTCTGGACAGCTGAGGAGGTTGAT
CTGTCCAAAGATCTGCAACACTGGGATTCCCTGAAAGACG
AGGAGAGATATTTCATCTCCCATGTTCTGGCTTTCTTTGC
TGCAAGTGATGGCATTGTCAATGAGAACTTGGTGGAGCGT
TTCACTCAGGAGGTCCAGGTGACTGAAGCCCGCTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations