Transcript

rrm2-209

ID
ZDB-TSCRIPT-141209-1657
Name
rrm2-209
Previous Names
  • ch73-187m15.5-001
  • ottdart00000053992
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053992 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053992|OTTDARG00000037730|ZDB-GENE-990415-25 rrm2|OTTDARP00000042423 CH73-187M15.5-001 LG_ CU695215.3 Danio rerio protein_coding NOVEL, 2072 bp
ATCGAATATAAAAAGCGTATCCGGCATTCATACTTAGTGT
TATCTTCGCTTCAGCTGGACCGTAGACCTGCTAGCTCTTA
GTTTTGCTTTTATTTATTTCTAGTTAACTTTGTTTTAGAA
GTTGTCTTTATTTTTAACCTTTAACTTATCCTCGTTTTGT
TTTACCAAACACTCCAAGCTTTACAATGTCGTCCACTCGC
TCTCCCCTGAAAACCAAGAATGAAAACACAATCTCTACTA
AAATGAATAACATGTCCTTTGTGGACAAAGAAAACACGCC
ACCCAGTTTGAGCTCCACCAGAATCCTGGCGTCCAAAACG
GCGCGCAAAATCTTTGATGAATCAGAGGGGCAGTCGAAAG
CAAAGAAAGGAGCAGTGGAGGAGGAGCCTCTTCTGAAGGA
GAACCCCCATCGCTTTGTCATTTTCCCAATTCAGTATCAT
GACATCTGGCAGATGTACAAGAAGGCAGAGGCCTCTTTCT
GGACAGCTGAGGAGGTTGATCTGTCCAAAGATCTGCAACA
CTGGGATTCCCTGAAAGACGAGGAGAGATATTTCATCTCC
CATGTTCTGGCTTTCTTTGCTGCAAGTGATGGCATTGTCA
ATGAGAACTTGGTGGAGCGTTTCACTCAGGAGGTCCAGGT
GACTGAAGCCCGCTGCTTCTATGGCTTCCAGATAGCAATG
GAAAACATCCACTCAGAAATGTACAGCCTGTTGATTGACA
CCTACATTAAAGATTCTAAAGAGAGGGAATTTTTGTTCAA
TGCCATTGAGACAATGCCATGTGTAAAGAAGAAGGCTGAC
TGGGCACTCAACTGGATTGGTGATAAAAATGCACGATATG
GTGAGAGAGTGGTGGCCTTTGCTGCAGTGGAGGGAATCTT
CTTCTCTGGGTCTTTTGCTTCTATTTTCTGGCTAAAGAAG
AGGGGACTCATGCCTGGACTCACCTTCTCCAATGAGCTGA
TCAGCAGAGATGAGGGTCTTCATTGCGACTTCGCCTGCCT
CATGTTTAAACACTTGATCAACAAACCATCAGAAGAAACC
GTGAAGAAAATCATCATGAATGCAGTTGAAATTGAGCAGG
AGTTCCTGACTGATGCTCTTCCCGTGAAGCTCATTGGCAT
GAACTGTGACCTGATGAAGCAGTACATTGAGTTTGTGGCT
GACCGACTGTTGCTGGAGCTGGGATTTGACAAGGTCTATA
GAGTGGAGAATCCTTTTGACTTCATGGAGAACATTTCGTT
GGAGGGCAAGACCAACTTCTTCGAGAAGCGAGTGGGCGAG
TACCAGCGCATGGGAGTCATGTCGGGAACTACAGATAACA
CTTTCACTCTGGATGCTGATTTTTAAAGACTCAATCTGAG
TGCTTCAACGGACACTTAACACAAAACTATGGACTTCTGG
GACTTTTGCTGTATAGTTTACATGTTTTTGTTTAACTTTG
TTTTAGCGAGATTAGTATTAAATAAGCTTTTTATTTTTGT
TTTACATAATAAAAAAAAAAATTTGAATTTCAACTTTTTG
GATGAGGTATTGCTCGAAGTATCAAGTTAGGTTTTTCAAG
ATATGGTGGCTCAATTTAGCCCAGACTCTATTTCGTGTAA
ATGAGGTAAAATGAGTTATGGAGATTTATACTGCATTTAG
TAGCTAGCTTGCCCCAGAGCAGACTAATAAGGCTAAGACT
AATCCTAGTGATTTTCTGTTAGTAATTCATTTAAGTTACT
CTGGCCATTTACTTATATTGGCAGTATAGATAATATTTCT
CACTTCCATATAAAGTATGGGATCGACTCATAAATTAAGG
TACAAATATAGAAACATGAATGGATAAAATAGATGCTCCA
ATATTGGGTAAGAGTATGCAGTTAGTTATTTAATAAACTT
TCCTGCATAACATGGTTGACTTTTGGTCACATTTAACACA
AAGTAAACCACTGCTAATTTGATGGTTATACTTTGGTGTA
GGTAACTTTACAGCATCTTCCCAAACCAGAACAGGGTTCG
AGACATTGCCACACTGTCCATCAAATTTTTTTTTTTTTTT
TTTTTTTAAATCAATAAAGAGAAAAATCGTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations