Transcript

rrm2-212

ID
ZDB-TSCRIPT-141209-2881
Name
rrm2-212
Previous Names
  • ch73-187m15.5-003
  • ottdart00000053993
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053993 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053993|OTTDARG00000037730|ZDB-GENE-990415-25 rrm2|OTTDARP00000042424 CH73-187M15.5-003 LG_ CU695215.3 Danio rerio protein_coding NOVEL, 909 bp
GAAAAACAAAGGATCTATACTCGTTGACTAGTTGTAAAAT
ACGTTTTCCGCTTAATTTGAGTTGTTTTTTTTATATGTCG
AGTTTAAAAATAATCAACAAAGTCCGTTGGAGTTCGTGTT
AACGGTTTAGTTGTGGTGAAGAACTGGCTAAACAGCTGAG
AGATTATTGTGGTGTAAAGTTTGATCGGCAATAAAATACT
GACACCTCTTTGATGACAGTAAATGTTATATTAATGATGT
GGTATTAGTGATATTATTGATGTCCAATATACGTTAATCT
TCGTGCTGAAGGACAGGAGAAACGACAACAAGACATTTAC
CTCTGTCATACGGAGGATTTGATGAAGCCACCCAGTTTGA
GCTCCACCAGAATCCTGGCGTCCAAAACGGCGCGCAAAAT
CTTTGATGAATCAGAGGGGCAGTCGAAAGCAAAGAAAGGA
GCAGTGGAGGAGGAGCCTCTTCTGAAGGAGAACCCCCATC
GCTTTGTCATTTTCCCAATTCAGTATCATGACATCTGGCA
GATGTACAAGAAGGCAGAGGCCTCTTTCTGGACAGCTGAG
GAGGTTGATCTGTCCAAAGATCTGCAACACTGGGATTCCC
TGAAAGACGAGGAGAGATATTTCATCTCCCATGTTCTGGC
TTTCTTTGCTGCAAGTGATGGCATTGTCAATGAGAACTTG
GTGGAGCGTTTCACTCAGGAGGTCCAGGTGACTGAAGCCC
GCTGCTTCTATGGCTTCCAGATAGCAATGGAAAACATCCA
CTCAGAAATGTACAGCCTGTTGATTGACACCTACATTAAA
GATTCTAAAGAGAGGGAATTTTTGTTCAATGCCATTGAGA
CAATGCCATGTGTAAAGAAGAAGGCTGACTGGGCACTCAA
CTGGATTGGTGATAAAAATGCACGATATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations