header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-2686
Transcript Name: anxa5b-201
Previous Name: anxa5b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046760 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046760|OTTDARG00000033287|ZDB-GENE-030131-9076 anxa5b|OTTDARP00000036832 anxa5b-001 LG_ FP102886.5 Danio rerio protein_coding KNOWN, 1881 bp
GCGAATTTCACTCCTCATTTCTGCTGCTTGCTCGCTTTGT
CCTGTTGCTCATCCGAACTTAGAAAGTCTTCTCCCGCTTC
GAACTCTTTGAAGTAGCCTATAGTCCACGAATCTCAAAGA
TGGCTGGCAGAGGAACAGTGAAGCCCCAAAGTGGATTCAA
TGCTAACAGCGATGCTGAGGTTCTCTATAAGGCCATGAAA
GGACTTGGCACGGATGAGGATTCTATTCTCCAGCTTCTCA
CCAAACGCAGTAATGGCCAACGTCAAGAAATCAAAGCTGC
GTACAAAACCCTGCATGGAAAGGATTTGGTGAATGATTTA
AAGTCAGAGCTGGGAGGGAAGTTTGAGGATCTTATAGTTG
CTCTGATGACTCCTCCCATCATCTATGAGGTCACATGTCT
GAGAAATGCCATCAAGGGAGCAGGCACAGATGAGAAAGTG
CTGATTGAGATCTTGGCATCTCGCTCTCCTAATGAAGTCA
ATGAGATCAAAAGTTCATACAAGCGAGAGCATGATAAGGA
CCTGGAGGAGGATGTGACTGGTGATACCGGGGGACATTTC
GAAAGAATGCTTGTTGTTTTGCTACAGGCCAGTAGACAGC
AAGGAATTCAAGAGAGCCTTATCCAAAGTGATGCTCAGGC
TCTGTTTGCTGCGGGAGAACAGAAGTATGGAACTGATGAA
GGCCAGTTCATCACTATACTGGGAAACCGTAGTAATGCTC
ACCTCAGGAGAGTGTTTGAGGAGTATAGAAAGCTGTCAGG
GTTTGAGATTGAGGAAAGCATCCAGAGAGAGACCTCAGGA
AGCCTCCAAGAAATACTGCTGGCTGTGGTGAAGTGTGCCC
GCAGTGTACCAGGTTATTTTGCTGACAGCCTTTACGCTGC
CATGAAGGGGGCAGGCACTGACGATCAGACACTGATCAGG
ATCATGGTGACACGCAGCGAGGTGGACTTGCTGGACATTC
GTGCTGAATTCCGCAAGCGTTTTGCAACCTCCCTGCACAA
AATGATTCAGAGTGACACTTCAGGAGACTACCGTAAAACC
CTGCTGCTGCTGTGTGGCGGTGATGATGCATAAACCATGT
CTTCCTCTCTGCCCAGCTCTGATCCCAGGATTTCGCTCTC
ATCTGTGGGTCAGTGGGATGAGGAACCAGTCCACCTCTAT
ACCCGACTGAGTATAAATGACAAAAACATAACATTTCACA
TCAGTAGAAGGATCTCTTGACTCACTGTGAAGATGCACTG
CATAGCACAGATTTACTTAATTCAAGTAAGCAATAAGCGA
ATTTTGTCTTTCACATTTCACATGATGTGTAATAGATTAA
GAGTGAAATCTGTAAACTACACAAGTAACATTCACTTTAT
GCTACAAGTTTGAAAGATAATAACTTTTTTTCGGCTTGAC
CTATGAAATCTATTACTGAAAAAAAAAGATGAATTTGGCC
TTATGAAGTTTATGAACCTCTATTAACTCAGCGCTTGATA
AAGAAAAGCAAAGACTCCTTGTACTTGATGAAGCAATGTT
TTATATGTATTCAGCTATTTTTCACTTATTTATTGTTTGT
ATGCTCACTAACTGCAAAGCATAACAATATTACAATCAAA
AATATAATTAGCTTCTGTTTATTTCACTGTATCTTTAACT
GCTTGTAGGTTTTAATGTGTGTGCTAGTTAAAGGAATGGT
TCACTATACTTATATCAGTGGTTTGGAGAACGAAATGTCA
TTTCATTGATTTCCTACTTCAGGTTTAAAACATGGTGCCA
GTCATTGGCTATGTAAGCGATACTCAGTTAAAAGCTGAAT
ATAACGGTGCTACTAAAAAAAAAAGGTTTAACATTTCATT
GATTTTATGTTATCAATAAACCCTCATGAAATAAAGGCAA
A

anxa5b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA anxa5b-201 1881
anxa5b-202 (1)    Ensembl 963
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
anxa5b-201 Contained in:
[Fosmid] ZFOS-2069A7 (1)

Genome Resources: Vega_Trans:OTTDART00000046760 (1),  Ensembl_Trans:ENSDART00000019698 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC046873 (1) 1930 bp
GenBank:BC155280 (1) 1900 bp
GenBank:BC065430 (1) 1849 bp
GenBank:BC164112 (1) 1021 bp
GenBank:EV755600 (1) 753 bp
GenBank:BM776825 (1) 662 bp
CITATIONS (2)