header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-245
Transcript Name: anxa5b-202
Previous Name: anxa5b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046761 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046761|OTTDARG00000033287|ZDB-GENE-030131-9076 anxa5b|OTTDARP00000036833 anxa5b-002 LG_ FP102886.5 Danio rerio protein_coding KNOWN, 963 bp
GCTTTGTCCTGTTGCTCATCCGAACTTAGAAAGTCTTCTC
CCGGCTGGCAGAGGAACAGTGAAGCCCCAAAGTGGATTCA
ATGCTAACAGCGATGCTGAGGTTCTCTATAAGGCCATGAA
AGGACTTGGCACGGATGAGGATTCTATTCTCCAGCTTCTC
ACCAAACGCAGTAATGGCCAACGTCAAGAAATCAAAGCTG
CGTACAAAACCCTGCATGGAAAGGATTTGGTGAATGATTT
AAAGTCAGAGCTGGGAGGGAAGTTTGAGGATCTTATAGTT
GCTCTGATGACTCCTCCCATCATCTATGAGGTCACATGTC
TGAGAAATGCCATCAAGGGAGCAGGCACAGATGAGAAAGT
GCTGATTGAGATCTTGGCATCTCGCTCTCCTAATGAAGTC
AATGAGATCAAAAGTTCATACAAGCGAGAGCATGATAAGG
ACCTGGAGGAGGATGTGACTGGTGATACCGGGGGACATTT
CGAAAGAATGCTTGTTGTTTTGCTACAGGCCAGTAGACAG
CAAGGAATTCAAGAGAGCCTTATCCAAAGTGATGCTCAGG
CTCTGTTTGCTGCGGGAGAACAGAAGTATGGAACTGATGA
AGGCCAGTTCATCACTATACTGGGAAACCGTAGTAATGCT
CACCTCAGGAGAGTGTTTGAGGAGTATAGAAAGCTGTCAG
GGTTTGAGATTGAGGAAAGCATCCAGAGAGAGACCTCAGG
AAGCCTCCAAGAAATACTGCTGGCTGTGGTGAAGTGTGCC
CGCAGTGTACCAGGTTATTTTGCTGACAGCCTTTACGCTG
CCATGAAGGGGGCAGGCACTGACGATCAGACACTGATCAG
GATCATGGTGACACGCAGCGAGGTGGACTTGCTGGACATT
CGTGCTGAATTCCGCAAGCGTTTTGCAACCTCCCTGCACA
AAATGATTCAGGTATCCTCATACACAGACAATACATAAAC
ACT

anxa5b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA anxa5b-201 (1)    Ensembl 1881
anxa5b-202 963
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
anxa5b-202 Contained in:
[Fosmid] ZFOS-2069A7 (1)

Genome Resources: Vega_Trans:OTTDART00000046761 (1),  Ensembl_Trans:ENSDART00000161874 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH546536 (1) 1019 bp
CITATIONS (2)