Transcript

hoxc3a-204

ID
ZDB-TSCRIPT-131113-4574
Name
hoxc3a-204
Previous Names
  • hoxc3a-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059220 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059220|OTTDARG00000016370|ZDB-GENE-980526-532 hoxc3a|OTTDARP00000046222 hoxc3a-004 LG_ BX005254.9 Danio rerio protein_coding KNOWN, 1027 bp
GTGCTGGCCTCACTGACGCGCTCTGCAGTCTGCCTGGCTG
TTTTGGAACCAGGAACCTTTCATTATGGAGTAATAAGACG
CTACGATATGATGGACTGAACACGGAAGAATTAAAGAGCT
ACAGCCGCGGCGAATGAATGAGAGAATCCTATGAGCGACG
TTAATCAGACCATGTGCAGAACGCTCAAGCTCATGAGGAA
ATTGTGAACGTGAGTGAAAGGACAACCTCATCGTTGCACT
GGAAAATCACTCGAAATGGCAAAACAGTCGAAGAATGCGG
ATGAAAACGGAATCACCGTTTGGCTGCTTACATGCAGTTT
ACAACTCAAACACCGAGTGCGCAAGGCTATTGGAGGAGGC
CACCACGTGACTACATTGTTTACTCTTGTTGGCAAACAAT
TAAAGACGCGAGAGAACAGTTCTACGTGGAAACGACATGC
TGAAGAAAGTTCATCAGAAAATGATAAAGGCAACGTGTGG
AACTTTCAAAACCTCTCGAATGTCCAACATCCCTATTCAT
TCTCTGATGATGGCAACCACTCTTTGGACCCTGCGAATGC
ATTGGAAAGAGAAAAGGCATGTGAGCTGTCAACTTCCTGC
TTATCAACCATGAAGTACCCTTGGATGAGAGAGACACATG
CACCCACGCACTTCAGCTCCATTAACGCCATGGAATCAGG
TGATTCTAAATACAGCAATGGTGAAGCAGTTGTACGGAAT
AGCAGCAGTAAACGGGCTCGTGTGGCGTTCACCTCCTCTC
AGCTGCTGGAGTTAGAGAAGGAGTTTCACTTCAGCGCTTA
CCTGTGCCGCAACCGGAGACTTGAAATGGCTGAGCTGCTG
AAGCTCACCGACCGGCAGATTAAAATCTGGTTCCAAAACC
GTCGCATGAAGTATAAGAAGGACCACAAGGAAAAGTCAAC
GGCAAAGTCCTCTTACACCTACCTGGGAACAGAAAACCAG
CCATTAATAATTAGCAGAAGCACAACAGATTCTCCAGTGC
CATTGAAATTCCAGAATAACTATGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations