Transcript

hoxc3a-201

ID
ZDB-TSCRIPT-090929-4538
Name
hoxc3a-201
Previous Names
  • hoxc3a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019664 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019664|OTTDARG00000016370|ZDB-GENE-980526-532 hoxc3a|OTTDARP00000016622 hoxc3a-001 LG_ BX005254.9 Danio rerio protein_coding KNOWN, 2836 bp
GATCCTTTTACTTGTGTTGCAATTTCCTTAACATTAAAGA
AACACATTTTTACAAAGCACGATGATAGAGATAGACAATG
TAGCCAATATGCTATTATTACTAAAGTATTTTATTCGCAA
TAAAACATCGCTAAAATGTACATCACTATTTACGTAAGAT
TAAAACCGGTTAAAATACGCAACTGAAGAACATTGGCAAG
CGTAAGGAACTGTTGTTAGATCAGCAAAGTGTGAAATGAA
TAGTTATTTAACCATAAAGCTAAACAAGTCGATCATTTTT
AAATACCTACCACAAGAGGACTGAAAAGTCAGTCAAAGAT
TTAAACATTGTTTTATAAAACATTATCACGGAAATTAAGT
CAGTATTCTTCAATCCATTGAAGCAAAAACTAAGACGACG
CGATCCCAGACATGTCTTTTCTCTGTCCAAAATGGGTCTC
TCTCTCTCTCCCTCCCACCTCACGCTCTCTGAACTCGTGT
CAGCACGATGACAGGGTAATGTATGCGCCCTGCTCATGGT
TTTTCGTCTGTCCACAGGAAAATCACTCGAAATGGCAAAA
CAGTCGAAGAATGCGGATGAAAACGGAATCACCGTTTGGC
TGCTTACATGCAGTTTACAACTCAAACACCGAGTGCGCAA
GGCTATTGGAGGAGGCCACCACGTGACTACATTGTTTACT
CTTGTTGGCAAACAATTAAAGACGCGAGTAAGTGTATTTT
TTGGCTTTCCTACACCTCGAATGAACAATTATATATTTCG
GGTGATTAGGACGATTAGAAATGAACAATAACTCGTTTCA
CGAATATAATTTTAACAGTGAATACTTAAACAAAATATGT
TGCAATAAATCTTATGTTTGTTATATGGGGCAACATTTCT
CCCCCTGTGCTCTGCAGGAGAACAGTTCTACGTGGAAACG
ACATGCTGAAGAAAGTTCATCAGAAAATGATAAAGGCAAC
GTGTGGAACTTTCAAAACCTCTCGAATGTCCAACATCCCT
ATTCATTCTCTGATGATGGCAACCACTCTTTGGACCCTGC
GAATGCATTGGAAAGAGAAAAGGCATGTGAGCTGTCAACT
TCCTGCTTATCAACCATGAAGTACCCTTGGATGAGAGAGA
CACATGCACCCACGCACTTCAGCTCCATTAACGCCATGGA
ATCAGGTGATTCTAAATACAGCAATGGTGAAGCAGTTGTA
CGGAATAGCAGCAGTAAACGGGCTCGTGTGGCGTTCACCT
CCTCTCAGCTGCTGGAGTTAGAGAAGGAGTTTCACTTCAG
CGCTTACCTGTGCCGCAACCGGAGACTTGAAATGGCTGAG
CTGCTGAAGCTCACCGACCGGCAGATTAAAATCTGGTTCC
AAAACCGTCGCATGAAGTATAAGAAGGACCACAAGGAAAA
GTCAACGGCAAAGTCCTCTTACACCTACCTGGGAACAGAA
AACCAGCCATTAATAATTAGCAGAAGCACAACAGATTCTC
CAGTGCCATTGAAATTCCAGAATAACTATGAAACACCATC
AATGAACTGGTGAAATTACAGAAAAACTGAAAACTGGTGA
CTTTTGCTTTTAGAACTTATATAATGATAGTAATCTGCAT
CAACCATAAAGACTGAAAATGAATGAATGAATGAATGAAT
GAATGTGTGAATGAATGAAATTTCTACAAAACATGTACAT
GATCTGTCACTGTTCAGCTATTTCTCCATTTGTAACTCTC
TCTGACATGATTTATATTTAAAAACATTGATGATTAATTG
CCTCTGGATGATGATTTATGTGCAAAGTTAACTTGGAAGA
GTTCAATAGGCAAGCTCGCTCTGAACCAGATTACATGATA
TCAGCTAGTACATTTCAGAGTTAGTCTCTATTGTGCATAA
ACTGCTGTAGTAATATCTTTGCAAAGCACCAAGATTTATT
GCAACCCTACTTGTGCAAGTTTATCTCTTGGGCACAGAAA
ATACAATTTTAAAAGGGCATTCAAGACTTTGAATGGTCAT
TAACATCCTCTCAACTTTTTAAGTGCACAACATATTTTTT
ATTACTCTCAAAATGATATGCTACTTTTCCCAAGGCATGA
GCTAAAATGTACAACTTGCAGCGTTGTTCATTATGATGGT
CACAATTGTTCCATGTTAAAGCCTATTGACCTGCTCTACT
ATTAACAATGAATTTGAATGACTTTTTTTCTGCTTTACAC
TGAAAGTAGGTGCGTTTAAGTCTGAATTTACAGCATATCT
ACTGACAAAATGAATGAAAGAGCAAAGCAGGATTTTCACA
ATGCTATATCAATGCATTTATAGTGTAATTACTTTACCCA
TTCATGTACACAAAAGTGTCAACATGGCAGCTGCAATGTA
AAATATGTGCATATTTGTAATTTATACCATTTCAATTATA
ACCTGTCCATATTTGACAAAAAAACATGCATTTTGAAAAT
AATAAGTGGTTGTTTTTTAAACTGATTTATTCCCTCTGGA
TAGTCAATAAATAATCATTGTAATTCATGTAACTGACAAT
AATGTTGTTTTGTTTAGTTAAAACAGGTAATGGTGAGTCT
AAATTTAGCTTAAAGGTGCTTCTGTGAATCTTACTTGATA
CTTTTTGAATTAGGCAATACTGTACTTTGCATTCTTAAAA
CATAACCTTACATATATGCCTTCCTCCGCCTCCGCCTACC
AACCTCGGAACATTAATCATTTAGACAAGGCTCTCTCTCT
CTCTCTCTCTCTCTCTCTCAGCTTCACAAGTGCTCAACCC
GCTGGGCCAAATGACAGGCTGTGCGCTTCTCTTCCAACAC
ACTTCTCTCCAATACGGGAGCTGAAATACATCTAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations