Transcript

hoxc3a-002

ID
ZDB-TSCRIPT-090929-4546
Name
hoxc3a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019708 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019708|OTTDARG00000016370|ZDB-GENE-980526-532 hoxc3a|no_translation hoxc3a-002 LG_ BX005254.9 Danio rerio protein_coding KNOWN, 737 bp
CTTGCGAGCTCGCGGTGGTGTTGAAATGATCTTAGCACCA
GACATTTTCCCCGTTTTCTGTTCGCCCACTAGTTTAGGCG
GATTTTAAAACGCTTTAAAACTCCATCTTGTCTCGTCTGC
TTTATCGCTAGTAATGACTGACTGTCCTCAGACGTCGCCG
CCTCCCCAGTCTCATTTCTACCTATCTGGTCCCCTAGAGG
GAAAACAATATTGATAGCTGGAGCTCGAGGGGTTAGAGTG
TGTAAATATGGTTATTTGTCCTCGAAAGACTACATTTTTC
CAGAGCACAGGAGAGTGGGATCTAGATCCTAGTGCCGTTG
CCTAGTAAGATATGCTGCTATCCGCCACCGAACGTGCGTC
ACACAGACAACAGCGACCGCTGCTCATGAGGAAATTGTGA
ACGTGAGTGAAAGGACAACCTCATCGTTGCACTGGAAAAT
CACTCGAAATGGCAAAACAGTCGAAGAATGCGGATGAAAA
CGGAATCACCGTTTGGCTGCTTACATGCAGTTTACAACTC
AAACACCGAGTGCGCAAGGCTATTGGAGGAGGCCACCACG
TGACTACATTGTTTACTCTTGTTGGCAAACAATTAAAGAC
GCGAGTAAGTGTATTTTTTGGCTTTCCTACACCTCGAATG
AACAATTATATATTTCGGGTGATTAGGACGATTAGAAATG
AACAATAACTCGTTTCACGAATATAATTTTAACAGTGAAT
ACTTAAACAAAATATGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations