header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-4555
Transcript Name: otx2b-203
Previous Name: otx2-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059150 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059150|OTTDARG00000020531|ZDB-GENE-980526-406 otx2|OTTDARP00000046183 otx2-003 LG_ CR936482.7 Danio rerio protein_coding KNOWN, 922 bp
GCAAAGGGCCCTGCGAGAGAAACAGACTCCAGTCCTGAGC
TCTTCATTGGCCAGCGCGCTGTACAAATCAGACTCCAGCA
ACTTCAACCCAGAAGAGCAGCGAATCATAACCAGCTGTAT
TCGCTATCGGACATCAAACTTTAACGGGCATCGGATTGAA
TCCAGTTATTCAGGTTTTTAGTTTTACCTCCACCGCTGAA
GACGCAAACAAGCTAAAGCAGAAGTGCGCTAAGGAAAAGA
GACCGAAGCAGCCGGTTTCCAGCTTTCCGAAATTTCTCCA
ACTTTACCCCCCACAACCATCTTTAGCATGATGTCGTATC
TCAAGCAACCACCTTACACGGTCAACGGGCTAAGTTTAAC
TACCTCCGGGATGGATCTTCTGCACCCCTCCGTTGGATAC
CCAGCGACTCCTCGAAAGCAGAGACGAGAAAGGACAACAT
TTACTAGAGCGCAACTAGATGTGCTGGAGGCTTTATTCGC
GAAAACACGCTACCCGGATATTTTCATGCGCGAGGAGGTG
GCCTTGAAAATCAACTTGCCGGAGTCCCGTGTACAGGTTT
GGTTCAAAAACCGAAGGGCAAAGTGTCGCCAACAGCAGCA
ACAACAACAAAACGGAGGCCAGAACAAGGTGCGACCTGCC
AAAAAGAAGAGCTCTCCAGCGCGGGAGGCCAGTTCTGAGA
GCGGGGCGAGTGGCCAGTTCACCCCGCCCTCCAGCACTTC
AGTCCCGGCCATCTCTACCACAACCGCTCCGGTGTCTATT
TGGAGCCCAGCCTCTATCTCGCCGCTGTCAGACCCACTTT
CTACCTCCTCCTCCTGCATGCAAAGATCCTACCCCATGAC
CTACACTCAAGCGTCTGGATATAGCCAGGGCTATGCTGGT
TCCACTTCCTACTTTGGGGGTATGGACTGCGGCTCATACT
TG

otx2b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA otx2b-201 (1) 2162
otx2b-202 (1) 2212
otx2b-203 922
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
otx2b-203 Contained in:
OTHER otx2b-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000059150 (1)
  • Ensembl_Trans:ENSDART00000156648 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH579448 (1) 952bp
    CITATIONS (2)