header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8446
Transcript Name: otx2b-201
Previous Name: otx2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025729 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025729|OTTDARG00000020531|ZDB-GENE-980526-406 otx2|OTTDARP00000021152 otx2-002 LG_ CR936482.7 Danio rerio protein_coding KNOWN, 2162 bp
TCATTTGCTTCACGGTTTGAAGAAAAGGATATTATCCTGA
TGTTATGAATATTTTTCTAATAATTTAGAGCTGTATTCGC
TATCGGACATCAAACTTTAACGGGCATCGGATTGAATCCA
GTTATTCAGGTTTTTAGTTTTACCTCCACCGCTGAAGACG
CAAACAAGCTAAAGCAGAAGTGCGCTAAGGAAAAGAGACC
GAAGCAGCCGGTTTCCAGCTTTCCGAAATTTCTCCAACTT
TACCCCCCACAACCATCTTTAGCATGATGTCGTATCTCAA
GCAACCACCTTACACGGTCAACGGGCTAAGTTTAACTACC
TCCGGGATGGATCTTCTGCACCCCTCCGTTGGATACCCAG
CGACTCCTCGAAAGCAGAGACGAGAAAGGACAACATTTAC
TAGAGCGCAACTAGATGTGCTGGAGGCTTTATTCGCGAAA
ACACGCTACCCGGATATTTTCATGCGCGAGGAGGTGGCCT
TGAAAATCAACTTGCCGGAGTCCCGTGTACAGGTTTGGTT
CAAAAACCGAAGGGCAAAGTGTCGCCAACAGCAGCAACAA
CAACAAAACGGAGGCCAGAACAAGGTGCGACCTGCCAAAA
AGAAGAGCTCTCCAGCGCGGGAGGCCAGTTCTGAGAGCGG
GGCGAGTGGCCAGTTCACCCCGCCCTCCAGCACTTCAGTC
CCGGCCATCTCTACCACAACCGCTCCGGTGTCTATTTGGA
GCCCAGCCTCTATCTCGCCGCTGTCAGACCCACTTTCTAC
CTCCTCCTCCTGCATGCAAAGATCCTACCCCATGACCTAC
ACTCAAGCGTCTGGATATAGCCAGGGCTATGCTGGTTCCA
CTTCCTACTTTGGGGGTATGGACTGCGGCTCATACTTGAC
GCCCATGCACCATCAGCTGACCGGGCCGGGATCCACTTTG
AGCCCCATGAGCAGCAACGCTGTCACCAGTCACCTAAATC
AGTCCCCCGCGTCCCTCCCCACACAAGGTTACGGTGCCTC
GGGGCTCGGCTTCAACTCCACCGCGGATTGCTTGGATTAT
AAGGACCAAGCGTCCTCATGGAAACTGAACTTCAATGCTG
ACTGCTTGGATTACAAAGATCAGACTTCCTCCTGGAAATT
CCAAGTGTTGTGAAACTAAAAACCATCTACCACTCTGTCC
AACCAACACACTAAAAGACCATAAAATAAACGTTGTAGAC
CTGCCATCCTTCCAATAACAGAAGTGTTCCGTGACGCGCG
AACTCTCCCAGATGGATGGGTTGCATTAAGCCCAAGAGCG
CTTGTGAAGTTTGAAGTCTTTGACATGAAATATCTATTTG
AGCTACACGCAACCCTTGCTGGCGTGCAGAGTAGTTTTTG
AAGGGTCGTGAATGCGTATAAACATAGGCCATTTGACCAC
AACCTGTTGTTAAAGGTGCAGGGAATCAAAGTGAATTTGT
AATAAGTTAGGTCAAAGCCACGGAACAAATCCTTACACAA
GAAAAGAGGAGAAAAAACTACACAGCAAAAGGAGCCAATC
TTTTGGTTAAGTGCTTGGAATGGGCAGGCTTTCTCTAAGC
CTCTTACAGCACGCCGACCTATTTCAATGTTGGCAAGACG
AGAGACACTTCCATCAGGAGGATGATAGAGAGGATGTGTG
CGAGTGTACGTGTGTGCGTGCGTGTGTGTGTGCTGAACGC
CCCCATGGCGACCTGGATGCACTACTTTATTTAAGAAAAG
GTGTTTATAAGGAATCAATATGTAGTTTTTAAAGACAATC
AATGTGTGTCTTATATAAATGGTACATTTGTGTTTTTTAT
CTGTGCTAGCCTTCGAAACTGTGATCTGTTGTAACTGTAT
GCAATTTGTGAGCTCCGTCGCATCTGCGAAGACTCGGCTG
TGATTTTAATAGATTTTAAACTTTTTTTTTTGGTTTGGAT
TTGTTTAAGAAAACACGACAGTAAATAATACTAGTCATAT
GATTGCTATTGGATTAATTTCAAGAGACAAACTATCTCGG
AAACACAGGGACTCAAGAGAATGTGTAAGAAAGGAACTGT
CTGTCCCCGTTCATTGATCTTCATTGGTCATAACTGCTAT
ACCACCCACGTGGATCTTAAACTTGTCTGGAGCGGTAATG
TGGTCCCGCCACAGAAATATTAATAAACAATTTCAAATCT
GA

otx2b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA otx2b-201 2162
otx2b-202 (1) 2212
otx2b-203 (1) 922
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
otx2b-201 Contained in:
OTHER otx2b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025729 (1)
  • Ensembl_Trans:ENSDART00000008816 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)