Transcript

smtnb-203

ID
ZDB-TSCRIPT-131113-1412
Name
smtnb-203
Previous Names
  • smtn-002
  • smtnb-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059403 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059403|OTTDARG00000029268|ZDB-GENE-070912-2 smtnb|OTTDARP00000046313 smtn-002 LG_ CU463315.12 Danio rerio protein_coding KNOWN, 304 bp
AGATGGAGACTGAGCCTGTTTCTCTTGTGGGTGAATCAGT
TATCGAGACGTCTCATGATGTCCCTGTTCTTCCTAACGGA
TCGTCCATGACCTCCATCAAAACTGAGGCGCAAAGCGAGA
AACTGACTTCCGAGAAGCTGCGAGACATCGAGGATGAGGA
GATCCTGGACAAAATGCTTGATGAGTGCAAAGATTTTGAA
GAAAGGAAAATGATCAGGACTGCGATGAGAGAACTGAGGA
AGAAGAAGCGAGACCAGCGGGAGAAGGAGCGCGATCAGCG
TCTGCTAGAGCTCAGGCAGCAGCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations