Transcript

smtnb-202

ID
ZDB-TSCRIPT-090929-20299
Name
smtnb-202
Previous Names
  • smtn-001
  • smtnb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040119 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040119|OTTDARG00000029268|ZDB-GENE-070912-2 smtnb|OTTDARP00000032070 smtn-001 LG_ CU463315.12 Danio rerio protein_coding KNOWN, 4492 bp
CTTAAACGTGATGTTAATCTGTGCGGGGTTTTTTTACAGT
CTACCTTTATCTCTCTTCACACACAGATGGAGACTGAGCC
TGTTTCTCTTGTGGGTGAATCAGTTATCGAGACGTCTCAT
GATGTCCCTGTTCTTCCTAACGGATCGTCCATGACCTCCA
TCAAAACTGAGGCGCAAAGCGAGAAACTGACTTCCGAGAA
GCTGCGAGACATCGAGGATGAGGAGATCCTGGACAAAATG
CTTGATGAGTGCAAAGATTTTGAAGAAAGGAAAATGATCA
GGACTGCGATGAGAGAACTGAGGAAGAAGAAGCGAGAGGC
TAAACTGGGATGCACACAGGAGGAGATGGACCAGCGGGAG
AAGGAGCGCGATCAGCGTCTGCTAGAGCTCAGGCAGCAGC
GCGAGGACAGATGTAAGAAAGCAGACGGCAGTAATGTGCT
GATAAAGAAGACGGAGCGCTCGGCTGACAGCTCCACTGTC
AGTCACATCACCAACCGCATTTCCCACACAGATGACGCTG
GAAGGACGTCCCGCAGCACCATCATGGAGTCCAGCTACAT
TCAGAAGACAGACAAAGGCACAACGCAAACAAAGTCCTAC
AGTTACTCCAGCACCACGTCCACTAGAAAGGTCGGAAGTG
TTTTTGACCGTGAGGACAACACGTCTCGCAGCTCCAGCAG
ATCTTCAGCTCTGGATCGCAGACAGGCCGAGAGATCGGAG
CTCATGAGGGCTCAGACGTTACCAAAGACATCTGCGGCTC
AGGCCCGGAAAGCCATGATCGAGAAGCTGGAGAACACCAG
CGGTAACTTGGCTATTGCTCAGGTGAACAGGGTTCAGCGC
TCTACCAGCTTCGGTGTCCCCAACGCAAACTCCATCAAAC
AGATGCTGCTGGACTGGTGCAGATCCAAGACCCGATCATA
CGAGAACGTGGACATCCAGAACTTCTCGTCCAGCTGGAGT
GACGGTATGGCTTTCTGTGCTCTGGTGCATAACTTCTTCC
CAGAGGCCTTCGATTACTCCAGCCTCAGTCCCACCAACCG
CAGGCAGAACTTCGAGACGGCCTTCAGCACAGCAGAGAGG
CTGGCAGACTGTCCGCAGCTGCTGGATGTGGAGGATATGG
TGCGGATGCGGGAGCCCGACTGGAAGTGCGTGTACACAGC
TTATGCCAACTGCATGCCCCTACTGGAGGTGGAGGACATG
ATGATCATGGGTAAGAAACCAGACTCCAAGTGTGTGTTCA
CGTACGTGCAGTCGCTGGTCAACCATCTGCGCCGCTGTGA
GATGATGAGAGCTCGAGCGCAGCAAACCTCCGACTTCTGA
CGAAGCTTCTACAAACTACAACTCTTCACTTCACAGACAC
TTACTAGACGTTTCAGTCAACCAAAAGGGCTTTTATACTA
TAGTAGATCCAAAAAGAAGGTTTATTTAAAGGGTCAGTCC
ACCCAGAAATGTTTTATTCTGTTATTCATTTCTTGATGTT
ATGTTGTTTTAATCAGTTTTTCATTCATCTTCAGAACCCA
GGGTTAAGATATTTTAGATGAAATCTGAGAGCTCTCTCAT
CCTCCTGAGATGTTCAACATCCAGAAAAGTGTTTCTGAGA
TTTTCAAAATGCATCACTATTATATTTTGAATCAATTTTG
AGTTTAGAATTTGACAGTAGAAGGTGCTCTAGGCTAATTT
TTAACAACAGAGGGTGCTGTAGGGTAGTATTTAACAGCAG
ATGTTACTTTTAGCTAGTTTTTAACAGCAGATGGCGCTCT
AGGCTAGTTTTTAACAGCAGATGGCGCTCTAGGCTTCTTT
TTAATAGCAGAGGACGCTCTAGGCTAGTTTTTTAACAGCA
TCCTAGACTAGTCTAGAGCGCCATCTGCTAATAAACACTA
GCTTAAAGTGCCATCTGCTGTAAAAACTAGCCTCGAGCAC
CGTCTGCTGTTAAACTGTAGGCTAGAGCGCCATCTGCTGT
TAAACTGTAGCCTAGAGTGCCGTCTGCTGTTAAACACTAG
CTTAGAGCACCATCTGCTGTTAAAAACTAGCTAAGAACAC
CATCTAGGTGTTAAAAATTAGCCTAGGGGCTATCTGCTGT
TAAACACTAGTCTAGAGCGCCATCTGCAGTTAAAAACTAG
CTAAGTGCATCATCTGCTGTTTAAACACTAGCCTAGAGCG
CCGTCTGCAGTTTAACACTTGTCTAGAGCACCATCTGCTG
TTAAACACTAGCCTAGGTAACTGTCTGCAGTTATACACTA
GTCTAGAGCCCCGTCTACAGTTATACACTAGTCTAGAGCG
CCATCTGCAGTTAAAAACTAGCTAAGAGCATCATCTGCTG
TTTAAACACTAGCCTAGAGCGCCGTCTGCAGTTAAAAACT
AGCTAAGAGCATCATCTGCTGTTTAAACACTAGCCTAGAG
CGCCGTCTGCAGTTAAACACTTGTCTAGAGCACCATCTGC
TGTTAAACACTAGCCTAGAGCACCGTCCCGTTAAACACTA
GCCTAGAGCGCCATCTGCTGTTAAAAACTAGCCCAGAGCG
CCATCTGCTTTTAATCACTAGCCTAGAGCACCATCTGCTG
TTAAACACTAGCCTAGAGCGGCATCTGCTGTTAAACACTA
CCCTAGAGTGCCATCTGCTGTTAAAAACTAGCCTAGAGCG
CCATCTGCTTTTAATCACTAGCCTAGAGCACCATCTGCTG
TTAAACACTAGCCTAGAGCGGCATCTGCTGTTAAACACTA
GCCTAGAGCACCATCTGCTGTTAAACACTAGCCTAGAGCG
CCATCTGCTGTTAAAATCGAAGCTTAAAATCAATCCAAGA
GCAAATAGTGATGCATTTTGAAAATCAAAACAATTTTTTT
TCACCACAGCTTTACAGAAAAGCAACCAAAAACTGTCAAA
AGTTCCACGTGACTGGTTGAACTGTAATCATACGAAGCTC
CAAGAACACTTTTGTGCACCAAAACAAATGTAAAAACTGC
TTTTGGAGCTTAGTGTTTTTACAGTTGAACTACCGAAGGC
TCAAGGAATTATCTGACAATGTTTTTTGGTTCCTTCCCAG
CACTGGGTTGCAGCTGGAAGGGCATCCGTTGCGTAAAACA
TTTGCTGGATAAGTTGGCAGTTCATTCCGCTGTGGTGACC
CTTGAGCAATAAAGGGACTAAGTCGAAAAGAAAATAAATG
AATGAATGTTTTTTTGGTTCCCTTTATACCAGGGGTGTCC
AAACTCAGTCCTGGAGGGCCGGTGTCCTGCTGGGTTTAGC
TCCAACTTGCTTCAAAACACCAGCCAGGAAGATTCTAGTA
TATCTACTAAGAGCTTGATTAGCAGTTTCAGGTGTGTTTG
ATTAGGGTTGGAGCTAAACTCTCCAAGACACCGGCCCTCA
AGGACCGAGTTTAGACACCCGTGCTTTATACAGTAGACAT
CAAGTGTCTCTGGACCCTTGCTGTCTACGGAGGACGAGAG
AGCTCTCTGATTTCATTTAAAATATCTTAATGTAAATTAG
GATTGGAACCGACACGAGTGTGTAATTAATAGCAGACTTT
TCATTTTTGAAGGACCGAACCCATAAATATTTTATTTTAA
AAAAGGAAAAGGTGATATTCAGTCCACTCATCAGACTCGT
ATTATAGCCTACTATTTCATTTGATGTCACAAACGAAACA
TTTTATGTTGATCGCCCTTGTTTACGATTTTAAAAGCTTT
TAAACCTGATCCGCAGTGGCCGTCAGTGGATCTTAGACCT
GCATGCTTTCACACGTTTACTTGAAGTTTTAGTTTGTTTT
AAATGAAGGTGACTTTTTTTCATTTTGTGTTTATTTAAAA
ACGTTGCAAGAGTATTAATCTCACTGCTTGTCATGGCTCC
GGCTCATTAAAATGTGTTTTTCACTTCACTATTGATGTTT
CTAGCCGAGCGTTTAGGTTTTTACACTGTTTGGGTTCGTT
TTAGACTGATGTGTTCCTGTTAGTCAGACTCATGTTGAAG
TGATATTTACAGTAAGTACACAAACAGCTTAATTATGCGT
GTGTGTATGCACTTTTGGGACTGTCAGTAATTATGGATGA
AGTTTAATCGCGTTTGTATTACTGAACTTCATTTTTAAAT
GAAGTTTGTCCCTTAAACGTACAGTAAGGTGTGTTTTTGT
ACATCTTTATTACACCTTGTAATTTAAACACTGTGTATAT
AGATATATATATGAGTAAACCCTAGCTGTCGATTTAAACT
ATTAATAATAATAATAGTGTTTTAGCAGGAAATTCATCTT
GAAAGGTCAGTGATGTTTATATATTTGGTTCTAAAGATAG
ATGTCGTTTGAATTGCTTTAATGACTGCACATAATTTAAT
GACAAACAGTGCAACTACACCAGAGACTTTGCTTGGTACT
CAACGGTTGCACTAGTCAAGCTAATTAGCATTATTCGTTC
ACAAATGTGAAGTCGTTTGTACACACTGTTGTTCACTCAG
TATTTCCCTACATGATGGTAACATATAGCAAGCATTAAAA
CCATAAACCATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations