Transcript

mia3-202

ID
ZDB-TSCRIPT-130528-206
Name
mia3-202
Previous Names
  • mia3-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058803 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058803|OTTDARG00000006547|ZDB-GENE-041014-270 mia3|OTTDARP00000045924 mia3-003 LG_none BX936461.17,AL935035.6 Danio rerio protein_coding KNOWN, 6798 bp
CCCCCAGCTGATCTGTGTGGTGTGTTGTTGGTGCTGCTAT
CTCTTTAAGCGCAGGCTCTGTAACCTGACTCCAGCTTCTC
TCCTCCTCACTGAAGCAGCTCAGCTCGCCTCCGGTCTGCT
GACGTGTCGGCAGCGGCTCCGCGATCAACAGCTGCCAGCA
TGGCTGCACCGAATAATCCCCGGTTTTACTCACTTTTTAC
CCTCCTCCTGTGCTCGTGCTTCGGCGGGAGCTGCTCGGAC
CGGCGGTTCTCGGAGCTGAAGCGCTGCGCGGATGAAGAAT
GCAGCATGCTTCTCGGCAGAGGAAAGGCCGCAAAGGATTT
CACGGGGCCGGACTGTCGGTTTCTCTCTTTTAAGAAAGGA
GAGACGATATATGTATATTATAAACTCTCAGGGCAGAGGT
CAGACGTGTGGGCTGGTAGTGTTGGAAACCACTTTGGCTA
TTTTCCAAAAGACTATCTTAATATAAATCATATATATACT
GAAAAAGAATTGGAGGTACCTACAGAAGAAACAGATTTTG
TTTGCTTTGAGACTGGGCTTGATAAATTTGAAAGTTATGA
CATAGATGTGTTATTAGGAAGCAAATTATTTATGGAAATT
GAGAATTCAACAGAAGAATCAAAAGAAGCAGATCCGTATG
ACATTTCTGAAACAGAAGAATCAGTGGAGCATCTTGATTC
AGAATCTCTGCTTGAATCAGAGGCAGTTCATTCAGAATCA
AGATTGCCTCTTCAATCAGAGTTGATCGATTCAGAATCAG
TATTGATTCTCCAACAAGAGTCAGTTGATTCTGAATCAAA
ATTGCCTCTTGAATTAGAATCAGTCAATTTAGAATCAGCA
TCGACTCATAAGTCAGTTAATTCAGAAACAGAATCGACTC
ATGAATCAGAGTTTGTTTATTCGAAACCTGCATTGACTCC
TGAATCAGAGTCAGTTGATTCAGAATCAAGAACAAAGTCA
ATTGATTCAGAATCAACAACACAGTTAACTAATTCAGAAT
CAACAACACAGTCAACTGATTCAGAATCAAGAACACAGTC
AACTGATTCAGAATCAACAAAACAGTCAACTAATTCAGAA
TCAAGAACACAGTCAACTGATTCAGAATCAATGTTAAAGT
CAACCGATTCAGAATTAACCACACAGTCAACCGATTTAGA
ATCAACTGATTCAGAATCAACAGCAGAGTCAACTGATTCA
GAATCAACAACACAGTCGAATGATTTAGAATCAACATCAC
AGTCAACGGATTCAGAATCAACAGCAGAGTCAAATGATTC
AGAATCAGCAACACGGTCAAATGATTCAGGATCAACATTA
CAGTCAAATGATTCAGAATCAGCAACACAGTCAAATGATT
CAGGATCAACATTACAGTCAAATGCTTCAGAATCAACGTC
GCAGTCAGCAGATTCAGAATCAACAACACAGCCAATTGAT
TCAGAATCAACATTGGCTCTTGAATCAGAATCATTTGAGT
CAGAATTAAAATCATTACCTCTTGAGTCAGAGTCATTTGA
TTCAGAATCAACACTGCCTCTTAAATCAGAGTCAGTAGAT
TCAGAATCTGTAGAAGCTTCTGAATCAGACACATTGATTC
CTAAATCTACTGAAGATGACTCTGATAGCTCTCAGCCAAA
GACCGTCGTCTCCTCAGAGTCAACACTGGAGCCTAAAGAA
GCAGCGACAGAAGAGACAGATACTTTAACAAGCCAAGATG
ATGTAGAAACACAACCATCAGATTTTGATGCACTAAACAT
TGATGATGTTGAACTTTTGCACATCCAACATGACTCTGAT
TCTGAGTCACAGCTTGAAACACAAACAGCAGGTTTAGATG
TAGATATCGAAGAGCCTGCTAGCCATAAAGATTTACCACT
ACAAACTTTAGAGAAAACACTTGAGGATGAGGACAGCTGG
TCATCAGCATTAAATGAAAAAAGTGAATCGAAAGAGACTG
AATCTTTTCACGAACACGCCAAAGAATCACTTTTAGTTCA
TGACCTCAAAGCACAAAGAGATTTTGAAGAAGAGGAAAAT
ATTGATGATGTGGAATTTTCTCATTCTCCTCACAATACGA
AATCTGCTTCAGATGAGAGTGAAGTCGTCCCATCTGAACC
AGCTCTGGAAACATTAGCATTAAATATAAGTGAAATCACA
GAGAATACAAAGGAAAATGCAGATGATTTTGTTATGAAGG
CCAGCATGAACACCAATGAAAATGCACACAAAAACATTGC
AGACGATGCTCGGGATGCAGCGATAAACAGAAGCCAACAG
CCTACAGAGTCCATCGATGAAGATGAAACTGAGAACGTTT
CTGAAAGCCCAGAATCTGCTCCTCTACTTTATAAAACAGA
CGAACAGATCGAAAAGGTGAAGAACGAACTGGAGGATCTG
CTTAAAAACACACTGGAGACTGAGGAAGATAGTCCTGGAG
GTGAAGAGGACGAGGCTGAAGAGCTTCTGGAAGACGAAAA
CGCTCTTCTTTCATCTAATAGTCCTCACCTCACAGACCAA
AATCCTGAAGACAATGAGCAACATGATGATGATGGTTTGG
TTGAATCTCAACAAAGCGAAAACACAACACAAGCAGATGA
AACTGAAACTGAAGAGGTTGGTCTTCCTCCTGAAGAGCCT
GAATACAGCGATAGCGTACTGAGACTCACAATATTGCGAG
ATCACTTGAAGGATGAGGATACCGAGCGCATGCAGAAGTA
CTTCGGCCTGAAGAACATGTTCAGAATCGAAGCCATGTTC
TCTGATCTGGATCTTGAGATGAAGTCTGCTCGGGAGATGA
AGACGGATACGGAGGAGATCGAGCAAACGCTGGACCAGAT
CACGGAGGCTTCAGAAAACTCCATTCTCGATGCCACAGAG
GACATACTTAACGACAGAGACCGGAAAGCTCTGGAGGATG
GACTGCAGAAGCAACCGGAGATGTATGATGTTGAGGCCGC
CATGTTGGACGCTTTTCAGGAGATCGTTTTCGCTTTGCGA
CAGAAATATTCGACAGCCAGCGACAGCGTCCCATTGGTCG
AGGAGGAACAAAGTGCATATGAAAGAGATGACCCCCGAGC
TGACGCTGAAGAGGTGAACAATCTGGACATTACAACTGAA
ATAACTGAGCCAGCTGAAACTCCTGAAATGCACAAGGAGC
AGAATGAATCTGAACCGATTCTGAATCCTGAATTGAACGT
GAACCCAGATTTGTCCCACAATAAAGATGTGGATCTTGAG
GAGGACGGAGGCCATTTCAACAGGAATAAAGACGCTCAAA
TCAGTTTCGAAGACGCTGAGGAGATCCAAAAGGGACCTCA
TGCTATTTTGGAGAAGCCAGTGGACATTGGCTTTCACTTT
GAGATGGATCCGTCTTCAGGTTCGTTGGAGTCTCCGAGTG
TCTCCGATTTCCATGATGCAGAAACTGGCAGTGATTCCTC
CGACTCATCGACTTCAGATGAACTTCAGGATTTGGTGGTG
CTTGTCAAAGAAAATCTGGGAGTTTATGGAGAGATTCTGA
TCACTGCGCTTCCAGAGGAATGGCGACCGGGTCCCAATTT
TCACGGAGTCCCCTGGGAGCCAGTGGTGGTCACAGTGGCC
ATCGGGGCCCTCACTATACTGATGTTCTTCTGGAGGACGG
TGCTCGCTATTAAAGGCAGAAGCTATCAGTTAACTGAAAA
GCAGCTTAGAGACAAAATCCAGCAGCTTCTCAATGAGAAA
TCTGATGCTGCGAACAAGATCACAGAATTAAATGACATGA
TAAAAGAAAGAGAACAACGCCTGCAAAACTCAGAGAAGTC
GCTGAGTTCCAGCCAACATGAAATAAAAGGGCTGAAGAAT
CATCACCAGAAAATGCAGAGTCAGTGGGAGCAGATGTCTG
GGAGTATTTCGCAGCTCAATCAGACAATTGTGGACACACA
GGAAGAAAACGCAAACCTTAATGAAAAGATTTCCAAGATG
CACCAGAGAATTGAGAAATACCAGAAAACACTGAAGAATT
ACGATGATGAGCGTGCAAAGGTTCATGTCCTTATGGATGA
AGCTAAACTCCGAGAAGACGCTCTTAAGGCTCAGGTTCTG
TCTTTTGAGAAGGAAAATGGTGCTTTAAAAGAGCAGAAGA
AATCTCTCCTTGGCGACGCTAAAGACTGGCAGGAGAAGCA
CAAGAAGCTGAGCGAGGAGATCCGAGTTTATCACAAATCC
CAGAAAGAGCTGGAAGACTCTCTGGTGCACAAGGAGAACG
AGATCGATGTTTTGTCCAGCTGTATCGCCGAGCTCAACCG
ACTGGGAGGCTGCGACTCTGCAGAGCTACAGAAAGAAGAT
GCTAGAATGTCTAACGGGGATGAATCTGAGAAGAAAATGG
ACACTATGAGACTGCGAATCAAACAGATGATGGACGTCTC
CAGGATTAAAGCCACTCTCAGCGTTGTGGAGGACGAGAGG
AATCGCTATATGGAAAATCTCCTCGCTGAACAGAAATCCA
GACAAGAGCTGGAAGAGCAATATCAGAAGGTCATGCATGA
CCAGATGAATCTGAACAATGAGAAAACGCATCTGGAGAAC
CAGATGAAGAACCTGCAGCAGAGACTGGAGATCACCACTG
AACTCTACCAGCAGAAGGAGAACGCACTGCAACAAAAGTT
GACTCAGGAGGAGCTGGAGAGACGCGAGAAGGAGACGAAG
CTGTCGGAGGTGGACAGTAAAGCGCTGCGCTCGGAGGAGG
AGGTTCGAGCTCTCAAGCAGAAGATAAAGGACATCGAGGA
GGAGATGCAGCAGAACGAACGCTCACTCAAATCTGAGGTG
GCAGTGCAAGAGAAGAAGGCCCATGAGAACTGGTTAAAAG
CACGCGCCTCAGAGAGAACTCTGGTGGAGGAGAGAAGAGA
ATCAGCCACTCTTCGGCAGAAGCTTGTGGAATACCGAGAT
AAAATATCCGACATGGAACAAAGTCTGTTTAAGTTGAACT
CTGGGCCGCCAGATCGACACATGCCGCCGCCACAGCGCAG
AGGGGATTCGTACGGTCCATCTCCTGTGAGCGGCGGGGCT
CCGTCTCCTCCTTTGATGATCGAGGGTCCAGGACGGCCCC
CATCAGCACCTGTAGGGCGACGCGGTGAGCCGTTCGGTCC
ACGACCCCCGTCTGATCCTCACGGACGCTTCTCTGAGCTT
GGACACCCGCTGCCATCCAGACCAGAAATGTTTCAGCCGA
TGACATCATCTCCATGTGCTCATGATGGGCCGATGCAGAC
GGCACCAGTCGTGGAGCCAGCCGAGTCCTCAGATCAGGCC
TCATCTGAGCCTGTAGAGTCTCTGTCCAAATCTCAGAGTC
AGGGATCCTTCCTGCCCTCCCCGATCCGAGATTCTCCGGT
TCCTCCACCTAACGTCCCGCTGAAGCCTTACGGTCCCCCA
GGGATGCCGCCCAATGGGCCACCGATGATGATCCGACCAC
CCAACGGACACCTTCCCATGATGCCCCCCGACCCGCGCTT
CAGACCTCCACACATGGACTCTTACGGCCCGCCTCCACAC
ATCGGCCCGTTTGGACCCGTGCCTCCACCTTTTGCTCGAG
GGCCTCCACTGGGGCCGCCACTCGGACAGCGGGACGTCCC
GCCAGATTTCTTTGCACCCCGCGGCCTCCCTCCTCGGCCC
TTTCCGCCTGGACCTCTGCCACCCCCCGGAGCCATGATCC
CTCCTCCATACAGCGGACACCGTTTTCCAGCAGCCCCTGC
AGTACTGTCTCAGAGCTCCAGAGATGGAGACGAGGAGCCG
CCGCAGACCCACGGGGAGCCCTGAAAAGCATCTGCGGAGG
GGAAACGATATTAGTTTGATTTGAGTTTTCTTTAATAACA
CATTTGCGAGCAGAAATAATGAGGGTTTTGATTTTATACA
TTAGCAAACCTTTCCTATGGAAATAGTTTGATTTAATTCA
CCTTTGTTTTGTCTTCTCTCCTGTGGTTAAACGATGACAT
CCACCACTCGCCCAGTGCTCATCTTGGGATATCGAACCAA
TATTTAGGCAAGCCATTTATTTCCTCATGCCTTTAATGTG
AGAGGACTTTTTTTTATGCCTTCCTCTTCTTCACCGTGTT
TTCGTTTGTTTGCTTTTAGTCTGATGATTCTCCAGCTCAC
GTAATACGATTCAGCCTGTGTTTATTTTAACGTTTGATCC
GTCGTGATTTCTTTTCCTAGCGGAAAGGCACATATGATGT
CATATTGACAAAGTATTTGTACATTTCTTTCAGCTGCGCG
TGTGTTATTATTCAGAAATCCCCAAACGAACACGTCAGCT
CAGATAAACGTCTTCTCTTTGAGTTTTCAGCGCCGTATGT
ATTAATTAAAGTCGTAGAGACGCGACTGTTTTTAACGACG
AAACATGAGAATGCATTTAGTTCCTGCATCAAATTGAATG
TGACCGTTTAGTGTGATTCTTTTATGAACAAATCTCTCTC
ATTCAGTTAAGACAGGAATCATTTTCGTTAAATTGCAATA
ATTTACTCTGCTATATTTCATTTAGCCCACAACCAGTGGT
GTTTCGTGGGTTTTTGATGCTACAACAAAAATAATCCCAA
TATTCAAAACTATTTTTTCATCTGCGTTTCATTTTTGGCA
TATGCCTCTTTTTTTTCTTTTTTTTTTTTGGTTTGGTATT
AGAGTAAATTATTTTAGGAAGTGTGTCGAGAGAATGCATC
TTGTGTAAGAGTGTCTGCATCATGTTGAAATCTTAGGGAA
GAAACGGTTTTAAAAACGAATGCGGCATTGATTTCATGGG
AATGAATGAATGAGTTGAATAAAGCTGCTTTTTCCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations