Transcript

mia3-201

ID
ZDB-TSCRIPT-090929-928
Name
mia3-201
Previous Names
  • mia3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007210 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007210|OTTDARG00000006547|ZDB-GENE-041014-270 mia3|OTTDARP00000006427 mia3-001 LG_none BX936461.17,AL935035.6 Danio rerio protein_coding KNOWN, 3652 bp
TGAGAGACTCTCCGCTCAGCGTTTTGAAATGTTGACGTGT
TGAAAGAGATCAACACTGATCTTACTCCAGCCGCGATTTC
AAAACATACTAACTATTTATATATATTTATTATCCATCTA
TGCTATTACTTCTTAGTTTAAACAGAATAGCTGTGTCAAA
CACGCGCGACAAAGCGGTTTTATATTAAAAATCCACCGGC
TTCCGATATGAACCAGCGGTCCGCCATTTATACACTGTTT
ATCGGCTTCAACCTCCGTTTCTGATCGCTAATAAATCAGC
TAAAACGCTTTATGAGGATGGACTCACAACCAATTCTTAC
CTCTCAACCAGCTGAGATAGAAAACACTGCCTTTTTCGTC
TTCATCCTGTCCAGACTTCACGAACTGATCACTGCGCTTC
CAGAGGAATGGCGACCGGGTCCCAATTTTCACGGAGTCCC
CTGGGAGCCAGTGGTGGTCACAGTGGCCATCGGGGCCCTC
ACTATACTGATGTTCTTCTGGAGGACGGTGCTCGCTATTA
AAGGCAGAAGCTATCAGTTAACTGAAAAGCAGCTTAGAGA
CAAAATCCAGCAGCTTCTCAATGAGAAATCTGATGCTGCG
AACAAGATCACAGAATTAAATGACATGATAAAAGAAAGAG
AACAACGCCTGCAAAACTCAGAGAAGTCGCTGAGTTCCAG
CCAACATGAAATAAAAGGGCTGAAGAATCATCACCAGAAA
ATGCAGAGTCAGTGGGAGCAGATGTCTGGGAGTATTTCGC
AGCTCAATCAGACAATTGTGGACACACAGGAAGAAAACGC
AAACCTTAATGAAAAGATTTCCAAGATGCACCAGAGAATT
GAGAAATACCAGAAAACACTGAAGAATTACGATGATGAGC
GTGCAAAGGTTCATGTCCTTATGGATGAAGCTAAACTCCG
AGAAGACGCTCTTAAGGCTCAGGTTCTGTCTTTTGAGAAG
GAAAATGGTGCTTTAAAAGAGCAGAAGAAATCTCTCCTTG
GCGACGCTAAAGACTGGCAGGAGAAGCACAAGAAGCTGAG
CGAGGAGATCCGAGTTTATCACAAATCCCAGAAAGAGCTG
GAAGACTCTCTGGTGCACAAGGAGAACGAGATCGATGTTT
TGTCCAGCTGTATCGCCGAGCTCAACCGACTGGGAGGCTG
CGACTCTGCAGAGCTACAGAAAGAAGATGCTAGAATGTCT
AACGGGGATGAATCTGAGAAGAAAATGGACACTATGAGAC
TGCGAATCAAACAGATGATGGACGTCTCCAGGATTAAAGC
CACTCTCAGCGTTGTGGAGGACGAGAGGAATCGCTATATG
GAAAATCTCCTCGCTGAACAGAAATCCAGACAAGAGCTGG
AAGAGCAATATCAGAAGGTCATGCATGACCAGATGAATCT
GAACAATGAGAAAACGCATCTGGAGAACCAGATGAAGAAC
CTGCAGCAGAGACTGGAGATCACCACTGAACTCTACCAGC
AGAAGGAGAACGCACTGCAACAAAAGTTGACTCAGGAGGA
GCTGGAGAGACGCGAGAAGGAGACGAAGCTGTCGGAGGTG
GACAGTAAAGCGCTGCGCTCGGAGGAGGAGGTTCGAGCTC
TCAAGCAGAAGATAAAGGACATCGAGGAGGAGATGCAGCA
GAACGAACGCTCACTCAAATCTGAGGTGGCAGTGCAAGAG
AAGAAGGCCCATGAGAACTGGTTAAAAGCACGCGCCTCAG
AGAGAACTCTGGTGGAGGAGAGAAGAGAATCAGCCACTCT
TCGGCAGAAGCTTGTGGAATACCGAGATAAAATATCCGAC
ATGGAACAAAGTCTGTTTAAGTTGAACTCTGGGCCGCCAG
ATCGACACATGCCGCCGCCACAGCGCAGAGGGGATTCGTA
CGGTCCATCTCCTGTGAGCGGCGGGGCTCCGTCTCCTCCT
TTGATGATCGAGGGTCCAGGACGGCCCCCATCAGCACCTG
TAGGGCGACGCGGTGAGCCGTTCGGTCCACGACCCCCGTC
TGATCCTCACGGACGCTTCTCTGAGCTTGGACACCCGCTG
CCATCCAGACCAGAAATGTTTCAGCCGATGACATCATCTC
CATGTGCTCATGATGGGCCGATGCAGACGGCACCAGTCGT
GGAGCCAGCCGAGTCCTCAGATCAGGCCTCATCTGAGCCT
GTAGAGTCTCTGTCCAAATCTCAGAGTCAGGGATCCTTCC
TGCCCTCCCCGATCCGAGATTCTCCGGTTCCTCCACCTAA
CGTCCCGCTGAAGCCTTACGGTCCCCCAGGGATGCCGCCC
AATGGGCCACCGATGATGATCCGACCACCCAACGGACACC
TTCCCATGATGCCCCCCGACCCGCGCTTCAGACCTCCACA
CATGGACTCTTACGGCCCGCCTCCACACATCGGCCCGTTT
GGACCCGTGCCTCCACCTTTTGCTCGAGGGCCTCCACTGG
GGCCGCCACTCGGACAGCGGGACGTCCCGCCAGATTTCTT
TGCACCCCGCGGCCTCCCTCCTCGGCCCTTTCCGCCTGGA
CCTCTGCCACCCCCCGGAGCCATGATCCCTCCTCCATACA
GCGGACACCGTTTTCCAGCAGCCCCTGCAGTACTGTCTCA
GAGCTCCAGAGATGGAGACGAGGAGCCGCCGCAGACCCAC
GGGGAGCCCTGAAAAGCATCTGCGGAGGGGAAACGATATT
AGTTTGATTTGAGTTTTCTTTAATAACACATTTGCGAGCA
GAAATAATGAGGGTTTTGATTTTATACATTAGCAAACCTT
TCCTATGGAAATAGTTTGATTTAATTCACCTTTGTTTTGT
CTTCTCTCCTGTGGTTAAACGATGACATCCACCACTCGCC
CAGTGCTCATCTTGGGATATCGAACCAATATTTAGGCAAG
CCATTTATTTCCTCATGCCTTTAATGTGAGAGGACTTTTT
TTTATGCCTTCCTCTTCTTCACCGTGTTTTCGTTTGTTTG
CTTTTAGTCTGATGATTCTCCAGCTCACGTAATACGATTC
AGCCTGTGTTTATTTTAACGTTTGATCCGTCGTGATTTCT
TTTCCTAGCGGAAAGGCACATATGATGTCATATTGACAAA
GTATTTGTACATTTCTTTCAGCTGCGCGTGTGTTATTATT
CAGAAATCCCCAAACGAACACGTCAGCTCAGATAAACGTC
TTCTCTTTGAGTTTTCAGCGCCGTATGTATTAATTAAAGT
CGTAGAGACGCGACTGTTTTTAACGACGAAACATGAGAAT
GCATTTAGTTCCTGCATCAAATTGAATGTGACCGTTTAGT
GTGATTCTTTTATGAACAAATCTCTCTCATTCAGTTAAGA
CAGGAATCATTTTCGTTAAATTGCAATAATTTACTCTGCT
ATATTTCATTTAGCCCACAACCAGTGGTGTTTCGTGGGTT
TTTGATGCTACAACAAAAATAATCCCAATATTCAAAACTA
TTTTTTCATCTGCGTTTCATTTTTGGCATATGCCTCTTTT
TTTTCTTTTTTTTTTTTGGTTTGGTATTAGAGTAAATTAT
TTTAGGAAGTGTGTCGAGAGAATGCATCTTGTGTAAGAGT
GTCTGCATCATGTTGAAATCTTAGGGAAGAAACGGTTTTA
AAAACGAATGCGGCATTGATTTCATGGGAATGAATGAATG
AGTTGAATAAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations