Transcript

nid2b-203

ID
ZDB-TSCRIPT-121213-875
Name
nid2b-203
Previous Names
  • nid2b-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058027 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058027|OTTDARG00000004045|ZDB-GENE-040724-143 nid2b|OTTDARP00000045443 nid2b-002 LG_ BX284679.5 Danio rerio protein_coding KNOWN, 768 bp
ATTGGAACCCGGTCCAACGAGGATGTAAAGCCCCCCTGTA
TATCTGGTGATGCCGCCCCACTCAACAATGCACTGATGTA
TCCGGTTATAAGCTCCTCCCCTTCAGGCCCTGCTATACTT
TACACACAAGCCTCACAGATTGGAGTCATTCCACTTGAAG
AAACAGACCCAGTTCAGGAAAAGTCCACTGTGTTATTAGC
CTTACAGACTTGATTCAGCCGGAGGGAATTGCAGTGGACT
CTGTGCACAGGATGCTGTTCTGGGCAGACAGTGGGAAAGA
CAAGATTGAGACATCTGGCCTGGATGGCAGTAAAAGAAGA
GTACTGATTGACTCAGGTTTGGTCAATCCCAGAGCCATCA
TAGTAGACGCTAAGAGTGGAACTGTATTCTGGACAGACTG
GAACCGTGATGCTCCCAAAATAGAAAGCTCATCACTGGAG
GGACGTAACAGAAAAGTACTGGTGCAAGTGGGTCTCATGT
TGCCCAATGCCTTGACATGGGACAATGCCACAAATCAACT
GTGCTGGGCTGATGCAGGCACAAAGAAACTGGAGTGCATA
TCTCCGGATGGGACTCAGAGACGTGTGTTCCAGGATACTT
TGAACTATCCGTTCAGTCTAGCCATCCATAACAAACACTT
CTATTACACCGACTGGGAGAGAGATGGGATACTGGTGATT
GACCAAAGCACAGGGAAAAACACAGATTATCTGCCCATTC
AGCAGTCACACTTATATGGGATCACATTTATCCCATCACA
ATGTCTAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations