Transcript

nid2b-202

ID
ZDB-TSCRIPT-090929-236
Name
nid2b-202
Previous Names
  • nid2b-001
  • si:ch211-13n20.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000004228 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000004228|OTTDARG00000004045|ZDB-GENE-040724-143 nid2b|OTTDARP00000003839 nid2b-001 LG_ BX284679.5 Danio rerio protein_coding KNOWN, 3546 bp
AACTGCTGGATTTTAGCTGTACTTTTAACAAATGTTCGTT
TTATGAAAGCGATTCAAAAGGAGAGACTTTTCCCTTTTGG
AATATCTGAAGGGGATTCAGTTCTTCAGGAAGGTGACGAT
GAAGTGTCCGCAGCCCTGAAGATAAAAAAGCCATTACAGT
TCTACGACATGCAGTTCAACATTCTTTATGTTTCCACAAA
TGGCTTTTTATCCCTTCAGCCTCCTCCTGAAGAGAGCCAG
TATCTAGGAAGCACCTTTCCTCTGAGTTTCTCTGCCATCG
CACCTTTCCTGACAGACTTTAGTTCAGGAAGAGGGAAAGG
ATCTGTGTTTTACCGTGTAGAGGAGTCAATAAATGTATTA
AACCGGGCTTCTGACATGGTTCAGCATGGTTTCACTGGTT
CTGCATTCAAGCCCAGCCACACAGTCATCGCCACATGGGA
CAACATCGAATGTGAAGTGGAAAAGCTCCTTCAGGTGACC
AGTTTCCAGGTTGTGTTGGCTGGTAATAAATCAGATACAT
TTGCCTTGTTCCTGTATCCTGAGGATGAGCAGCAAATGCT
AAATATCAGTCACAATTATGCTAACATGTCAAAAGGAGAT
GTCAAACTGCAGGCTGGTTTTAATAGAGGCGATACATCGA
CCACAGGAGAGCTGTTTTACAGTCTGCCTGGCTCTAAAGA
GAACATCAACCTCTATAGGGAGGGGAACATGGGAATAAGC
GGACTGTGGATTTTCCACATCGGATCCAGCCGCTTCCCTT
TTCAGAATATAGTTCCTGCTTCTGTCACCAAGTCTGACTC
TATGGGTTATAAAACCACTCAAAGAACCACAAAATCAAAT
ACAACTGCAGATGAATCTGCTTCTGAGCCTCAGGTGGACA
ATCCAGCTTCACTTGTTCAACAGCCCTTAAAACCAAACCA
AGAACTACAACAAGTCAATGTAACCAAAATGTGTGGTTTG
CACCTGAGATTCTGCTCTGTGGATGGATACTGCACAGACT
ACCCAACTGGGCCATGCTGTTACTGCAGAACCGGCTACTA
TGGCAATGGCAGACATTGTTTACCCATGGGTATTTCTCAA
CCTTTGAGTGGAAAGCTGAGTGGCCATGTTTCTGTTGGGG
GCACTAAAGTTCAGCTAAACAGTGTGGACCTCCATGGCTT
TGCGGTGGTGGGAGAAGGTCGTGTGTATGTCTCCATCAGT
CCTGTCCCAGCTAGGGTGGGCTGGGCTCTGATGGCTGTGG
GCCCGCTGGTCTCCACATTTGGCTGGCTCTTTGCTCTTGA
GCTCCAGAACCATCCAAATGGCTTCAGCATAACTGGAGCT
GAGTTTTTCTACAAAGCAGAGCTGGTGTTCAGCCCACAAG
GACAGCGTGTTGTCATTATTCAAGAGGCTCAAGGAATGGA
TTCATTCAACCACTTGAATTTTGACATTAACATCATTGGA
GATTTACCTAGCATTCCCAGTGGAGCCAAAGTTCATATTC
TGCCATATACAGAGACCTATCACTACAACCATTCAGTGTT
GACATCATCTTCACTGCGGGAGTACATGGTGGTGTCAGAA
AATGGTGGATCTGAGACGTTGTCCTACCTACTACAGCAGA
ACATGAGTTTCAGTGGATGTGCACATGATCCCAGGACCAC
ACCAGACTTTCAGCAGGTGAACGTGGAGCATCTGATGGTC
ATGTTCACAGAGGGAAACACACTCAGATATGCCATCAGCA
ACAGAGTGGGACCTGTAGGAGGTGAGCTACCTGGACTTGT
AGAGTTGAATCCATGTTTAACTGGGAAGCACCATTGTGAC
CCGATGGCCCTCTGTCTGCCAGGGGACGGCACTCAGTATC
TCTGTCAGTGTGCTATGGGCTACCAGGGCGATGGACAAAA
CTGCTACGATGTGGATGAGTGCGCGGAGGGGCTCAGTTCC
TGTGGTCCTCATTCTGACTGTGTGAACATGCCGGGTGGCC
ATCACTGCCACTGTCAGTCTGGCTACGAGTTTGACCTCGA
TTTGCATGAGTGTGTGGATATCGATGAGTGTTTCGAGGAG
CTCTGTCATCCGTTTGCTTCCTGCTCAAACACCCAGGGCT
CGTTCCGCTGTCAATGCTGGCCTGAATACAAGGGCGATGG
CTTCCTCTGCCAACCACCACCAAAAAGGCCCAAGCCTTCA
TTAACTGCATGCCAGCAGCACAGAAACAGCCTGCAGGAGA
GTATGAGCATGTATCCAGCTCTGGAGGCTTTTGTTCCAAA
GTGTGATGATAAAGGCCAGTACAAACCCCTGCAGTGTTTG
GGCTCCACTGGACACTGCTGGTGTGTGGACAGCAGGGGGC
AGGAGAGAGTGGGCACCAGGACAATGCCTGGCACAGCTCA
TGCCAACTGTGATCAACCAGCTGCTCTGGTTCCCCGTGTG
GAGACTGTGTGTGAGCGTTGGAGGCTTGCACTCATGAGTC
ACTATAATGGTCAGCCGTCCTCTCAGGACTACATGCCCCT
CTGTGACGCTCACGGAAATTTCCAGCCTGTGCAATGTTAT
GGCAACAGCGCTTTCTGCTGGTGTGTGGACCGACATGGTG
TTGAAATTATTGGAACCCGGTCCAACGAGGATGTAAAGCC
CCCCTGTATATCTGGTGATGCCGCCCCACTCAACAATGCA
CTGATGTATCCGGTTATAAGCTCCTCCCCTTCAGGCCCTG
CTATACTTTACACACAAGCCTCACAGATTGGAGTCATTCC
ACTTGAAGAAACAGACCCAGTTCAGGAAAAGTCCACTGTG
TTATTAGCCTTACAGGACTCGGTTGTGATTGGAATTGACT
ATGACTGTCAGGAGAACATCTTGTATTGGACAGATTTTGG
ACGACATACAATTTACAGAGCAGTTCTAATATCTGGGTCT
GAACCAGAGGCTGTTATCAGCAAAGACTTGATTCAGCCGG
AGGGAATTGCAGTGGACTCTGTGCACAGGATGCTGTTCTG
GGCAGACAGTGGGAAAGACAAGATTGAGACATCTGGCCTG
GATGGCAGTAAAAGAAGAGTACTGATTGACTCAGGTTTGG
TCAATCCCAGAGCCATCATAGTAGACGCTAAGAGTGGAAC
TGTATTCTGGACAGACTGGAACCGTGATGCTCCCAAAATA
GAAAGCTCATCACTGGAGGGACGTAACAGAAAAGTACTGG
TGCAAGTGGGTCTCATGTTGCCCAATGCCTTGACATGGGA
CAATGCCACAAATCAACTGTGCTGGGCTGATGCAGGCACA
AAGAAACTGGAGTGCATATCTCCGGATGGGACTCAGAGAC
GTGTGTTCCAGGATACTTTGAACTATCCGTTCAGTCTAGC
CATCCATAACAAACACTTCTATTACACCGACTGGGAGAGA
GATGGGATACTGGTGATTGACCAAAGCACAGGGAAAAACA
CAGATTATCTGCCCATTCAGCAGTCACACTTATATGGGAT
CACATTTATCCCATCACAATGTCTATAGAGACCCTGTGGA
TCTCTGCAGTTACAGAGACTGTAAGGATTTTTGGAATATA
AATAAATGACAACAAAACAGAAACAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations