header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-857
Transcript Name: irf9-203
Previous Names: irf9-003, ch211-198p7.5-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057973 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057973|OTTDARG00000021790|ZDB-GENE-040912-165 irf9|OTTDARP00000045401 CH211-198P7.5-003 LG_ BX571950.6 Danio rerio protein_coding KNOWN, 614 bp
TACAGGTGTTACAATTATCGTAACTGGAGCTGTCATTGTA
TGATTCTTTTCAGATGGCATCTGGAAGGATACGCTCCACA
CGCCGTCTGCGTTCATGGATAGTAGAACAGGTGAATAGTG
GGAAGTATCTCGGCCTGGTTTGGGACAACCCAGAGAAAAC
CATGTTTCGCATCCCATGGAAACATGCAGGAAAACAAGAC
TTTCGCAGTGAGGAAGATGCAGCTATTTTCAAGATTATTA
ATTGGCCTAACGTTAACCGTGTGCGTGTGATCATTCTTTG
ATAATTACACACGGCTTGGGCGGCGTTTAAAGGGAAGCTC
ATGGAAAATGGAAATTCGGACCCTGCGTCCTGGAAAACAC
GCCTTCGATGTGCCCTCAACAAAAGTCCAGAATTTAGTGA
GGTCACAGAAAGGTCACAGCTGGATATTTCAGAACCCTAC
AAGGTGTATCGCCTTGTACCACCAGAAGAACAAGGAGTGG
TTAAAGTTAAAAAAGAGAATGGTCAGAAATCAGTGAGAAA
CAGCAAGAGGAAACACAGCGAATCTGAGAATGAACAGGAG
ACTGAAGGCAAGAAGATCAAAGAGGAGATTGTTGCACCAC
AGGCCATCAACATG

irf9 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript irf9-203 614
mRNA irf9-201 (1)    Ensembl 1767
irf9-202 (1)    Ensembl 538
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
irf9-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000057973 (1),  Ensembl_Trans:ENSDART00000152751 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CN327334 (1) 904 bp
CITATIONS (2)