header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-544
Transcript Name: irf9-202
Previous Names: irf9-002, ch211-198p7.5-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057972 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057972|OTTDARG00000021790|ZDB-GENE-040912-165 irf9|OTTDARP00000045400 CH211-198P7.5-002 LG_ BX571950.6 Danio rerio protein_coding KNOWN, 538 bp
ACAGAACGACTGATACTGCACAGGACCGACACTAAAGATG
GCATCTGGAAGGATACGCTCCACACGCCGTCTGCGTTCAT
GGATAGTAGAACAGGTGAATAGTGGGAAGTATCTCGGCCT
GGTTTGGGACAACCCAGAGAAAACCATGTTTCGCATCCCA
TGGAAACATGCAGGAAAACAAGACTTTCGCAGTGAGGAAG
ATGCAGCTATTTTCAAGGCTTGGGCGGCGTTTAAAGGGAA
GCTCATGGAAAATGGAAATTCGGACCCTGCGTCCTGGAAA
ACACGCCTTCGATGTGCCCTCAACAAAAGTCCAGAATTTA
GTGAGGTCACAGAAAGGTCACAGCTGGATATTTCAGAACC
CTACAAGGTGTATCGCCTTGTACCACCAGAAGAACAAGGA
GTGGTTAAAGTTAAAAAAGAGAATGGTCAGAAATCAGTGA
GAAACAGCAAGAGGAAACACAGCGAATCTGAGAATGAACA
GGAGACTGAAGGCAAGAAGATCAAAGAGGAGATTGTTGCA
CCACAGGCCATCAACATG

irf9 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript irf9-203 (1)    Ensembl 614
mRNA irf9-201 (1)    Ensembl 1767
irf9-202 538
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
irf9-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000057972 (1),  Ensembl_Trans:ENSDART00000152397 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH115146 (1) 915 bp
GenBank:CK025667 (1) 758 bp
GenBank:BG737308 (1) 501 bp
CITATIONS (2)