Transcript

smarcd2-201

ID
ZDB-TSCRIPT-121213-514
Name
smarcd2-201
Previous Names
  • smarcd2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057746 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057746|OTTDARG00000040230|ZDB-GENE-080215-1 smarcd2|OTTDARP00000045242 smarcd2-001 LG_ CU459020.8 Danio rerio protein_coding KNOWN, 3116 bp
ACCATTATGATAAATGGGGGCTTGACAAGCTTTAGAGGAA
GAGATGACACGCTCAACCGACATCGATAGACAGTTACACA
GATACTGACGAATATATCGACATGTGAACGCAATGTGCTC
ACGCCTGACTCAACCGGACGCTTTTCGAGTAACTCAATAA
CTGTTTTGATTCGTTTATTAGCAATTATTAGCGTTGAAAA
CCATCAAACATGTCTTCGAGATCGGGTTTCTCGGTCAACC
CCAGTACCCCAATAAACCCCGGGATGAACCCCATGAACCC
CGGTCACAGCAGCGCCCCGAGAATGCCAGCATTGCCTTTG
AATTCACCCTACAGAGGGATGAGCAGCACCCCGAACCAGT
ACCACCAACGGCCAAGTATGCCACTCAGCCGAGGAATGCC
AATGGGGGGCATGGGGTCTATTGGTTCCCCACTGCCTGGT
CCATCATATAGTGGAGCCATGCCTATGCGACCTGGAATGC
CTCAATCTGCGATGGACCCGACCCGAAAGAGACTCCTTCA
ACAGCAGCCTGGGGGTCTTATGGGCCCAAGAAGAGGAGTG
AAGAGGCGTAAGATGGCTGACAAAGTCCTCCCACAGAGGA
TCAGGGATTTGGTCCCAGAGTCTCAGGCATACATGGACCT
TCTGGCCTTTGAAAGAAAACTGGACCAGACCATTGCTCGC
AAACGCATGGAGATACAGGAGGCCATCAAAAAGCCCATCA
CGCAAAAACGCAAGCTGAGAATCTACATTTCGAACACTTA
CACGCCTGGCAAGCCAGAGGGCGAGGAGGCTGAAAAAGTG
GCATCCTGGGAACTTCGAGTGGAAGGCAAACTCCTGGAGG
ATCCTGGGAAACTGAAACGAAAGTTCTCATCCTTCTTTAA
AAGCTTGGTCATTGAACTGGACAAAGAACTTTATGGCCCA
GACAATCACTTGGTGGAGTGGCACAGAATGCCCACGACTC
AGGAGACGGATGGATTTCAGGTGAAGAGACCAGGAGATGT
GAATGTGAAATGCACTCTGCTTCTCATGCTGGACCACCAG
CCTCCACAGTACAAGCTGGACCCACGTCTGGCTCGACTGC
TGGGTGTCCACACTCAGACCAGAGCCAGTATCATGCAGGC
CCTGTGGCTCTACATCAAGAACAACAAGCTGCAAGATTGC
CACGAGAAAGAGTACATTAACTGCAACCGATACTTTAGAC
AGATCTTTGGCTGCCCCAGGATGAGATTTTCGGATATCCC
CATGAAGCTCGCCAGCCTCCTTCAACACCCCGACCCCATC
GTCATCAATCATATCATCAGTGTGGATCCCAACGATCAGA
AGAAGACTGCTTGCTTTGATATTGATGTTGAGGTTGACGA
CCCTCTGAAGGCTCAGATGACCGGCTTCCTGTCCTCCACA
ACCAGTCAGCAGGAGATTGCTACTCTGGAGATGAAGATCC
ATGAGACTATTGAGTCCATCAACCAGCTGAAGACCCAGAG
AGACTTCATGCTCAGCTTTAGTAACAGCCCACAGGAGTTC
ATCCAGGACTGGCTCAAGTCTCAGAGCCGAGACCTCAAGC
TAATGACAGATACTGTGGGAAATCCAGAAGAGGAGAGGAG
GACTGAATTTTACCACTCACCCTGGGTCACAGAAGCTGTT
GGACGATATATATTTTCAAAGGTCCAGCAGAGGAGACAGG
AGTTGGAGCAGGTACTTGGAATCCGACTCACTTAAGAAGA
TTCAGACTCCAAATCCACAATCATCCGAGCAACTGATTCA
ACAAATGTTGAATCAGTTTCTGTTTCATAACCAGCGGATG
CACTTCATGTGGGTTTTTGGTACTGGTCATAAACAGCTTG
TCAGGTGCAGCATTTGCAGTACCATTACACACATCTGGCC
AAATATATTTCAAGCGCTGTTACAATAACTGGAATGCCTC
AGTTGCTATCTTCCCTTCTCTGGTCTTTATTTCTATATTG
TGAAAAGAAAATATGAAAATAAGCCATTGAGTTCATGGCC
TTTATTTGACATACACTCATACACAATAATACTCTTGTAA
TTTTTTTACAGTACAATGCAGTACTGTAGTTTGTTTGTTA
AAACCCCATTGGAAATAGATAACAATCTTGATTTTGTGTT
TTTAGTAGGAATTGCTGAAGTCAATTTGCCATTTTGTTTC
TGATTCTTACAGCAAAGGATATTCCAACAAAATTAATTGC
ACACGTTTTGAGTTTATATGCTTGCAATTAAGTAGACTAG
CAATGAAATGTTTTCAATATTGTGGATTTTTCCATTTGGT
CTCTCAGGAAAAATATGTGCTGCACTGCGTTCAAGAGCCA
TGTCTTTGTGTTTCCACCCCAGCACATTTGGATATCCAGC
TGTTTTAGTTCAATTTACCAGACTTTCTGTCTTCATCTAG
TTAGTGGTATTAGTCTTTTTTTATTTAGTGTTTGAAAGTC
TGCTAAAGAGACACAGCAGTGACCACATTTGTCAAAGACG
ATGTTTTAGATATGCAAGCCATCAGCATAATTGATATTTT
CAGGTATACCGAAGCCATAATGTTACTTAATAATAAGTAG
TTCACTTCAGCGTGCACTTTTACATTCCAAAAAGCTGTTG
GACGTTTTGTTTAAGTGTGTTTTAATTCATTTTTTGCAGT
CGCTTATGTTAAGTATAGATGACAGCAAACTGAATTTTAA
AACAAGGAATATAACAGGTGGTTATAATAATAAAAATAAT
AAGACAGGAAGACTGGTGAGGAAAAAATGTGCTGACAGTA
GGATGTTGAAAATTAAATTCTAGCTTCTATTTTTAATGCA
TCTCTGATGGTTGAGCTGAAAGCATGTCACAGATTTCTTT
CCATAAAGTTTTGTGTTTTTCAATAGTTTATTTTGCTAAT
TGCTCAATTGCTCAGACAGTATTAATGCTGATCTGAAATG
CAACTAGTGTTTTTGTTTTACGCCTTTGTGCCTTTGATTT
ACTTGTTAACTGATTACATTTGTGTTTGTGTGTGTTAAAT
GCAATTAAGTTCTTACAACTGTTCTGTTTTATATTTTTGT
ATTAATCAAATGCTTATCTTTTGTACTTTTTTATGAGAAA
TTTGAGTATTTTCAGCAATAAAGTTGGTTTCATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations