Transcript

smarcd2-202

ID
ZDB-TSCRIPT-121213-205
Name
smarcd2-202
Previous Names
  • smarcd2-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057745 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057745|OTTDARG00000040230|ZDB-GENE-080215-1 smarcd2|OTTDARP00000045241 smarcd2-002 LG_ CU459020.8 Danio rerio protein_coding KNOWN, 724 bp
ACCATTATGATAAATGGGGGCTTGACAAGCTTTAGAGGAA
GAGATGACACGCTCAACCGACATCGATAGACAGTTACACA
GATACTGACGAATATATCGACATGTGAACGCAATGTGCTC
ACGCCTGACTCAACCGGACGCTTTTCGAGTAACTCAATAA
CTGTTTTGATTCGTTTATTAGCAATTATTAGCGTTGAAAA
CCATCAAACATGTCTTCGAGATCGGGTTTCTCGGTCAACC
CCAGTACCCCAATAAACCCCGGGATGAACCCCATGAACCC
CGGTCACAGCAGCGCCCCGAGAATGCCAGCATTGCCTTTG
AATTCACCCTACAGAGGGATGAGCAGCACCCCGAACCAGT
ACCACCAAAGTGAAGAGGCGTAAGATGGCTGACAAAGTCC
TCCCACAGAGGATCAGGGATTTGGTCCCAGAGTCTCAGGC
ATACATGGACCTTCTGGCCTTTGAAAGAAAACTGGACCAG
ACCATTGCTCGCAAACGCATGGAGATACAGGAGGCCATCA
AAAAGCCCATCACGCAAAAACGCAAGCTGAGAATCTACAT
TTCGAACACTTACACGCCTGGCAAGCCAGAGGGCGAGGAG
GCTGAAAAAGTGGCATCCTGGGAACTTCGAGTGGAAGGCA
AACTCCTGGAGGATCCTGGGAAACTGAAACGAAAGTTCTC
ATCCTTCTTTAAAAGCTTGGTCATTGAACTGGACAAAGAA
CTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations