Transcript

jag2b-003

ID
ZDB-TSCRIPT-121213-301
Name
jag2b-003
Previous Names
  • jag2-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058175 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058175|OTTDARG00000005397|ZDB-GENE-011128-3 jag2b|no_translation jag2-003 LG_ BX004766.9 Danio rerio protein_coding KNOWN, 812 bp
GATCCTACACACTCATCCTTGAAGCTTGGGACTGGGATAA
CTCCACTCAGAACAATGGTGAAGAAAATTTGATCGAACGG
CACATTCACGCAAGCATGGTAAACCCCGGCGACCACTGGC
AGTCCATCCGGCACCCTGGCATCACGGCCCACATTGAGTA
CCGCATCCGTGTCAGGTGTGATGAGAATTACTATGGGAGT
AAGTGCAACAAACAGTGTCGCCCACGAGATGACTACTTCG
GTCATTACCGATGCGATCCATCTGGAAATATTGTGTGTCT
TGATGGCTGGATGGGAGAGGACTGTCGGACAGGTGGGTGA
CGTTGACCATCTTTGTTTTGTGCTTTGCATTTTAGTTTTA
AGTTATATACATTCATTCATTTTCCTTCGACTTAGTCCCT
TATCAGGGGTGGCCACAGCAAAATGAACCACCGACTATTC
CAGCATATATTTTACACAGCGGATGCCCATCCAGCCGCAA
CCCAGTAGTGGGAAAAAGTAATGAAGAAAACATGGATAAT
ATTCATACTTCAAGTTCTTTGTTATTATTTTGTCTGTGTA
AAAACACGTGACCAGTGTTTTCAATACTGTTACATACATT
GTAAAAATTATATGTTCAATTAGTCCTGACAGCATATGTT
TTTAGGTTATGGTAACTTATTAAAATAAGTTAATCATGTT
CTAATGTAATTTTATAAGTTTTGCAAGCTGTTTCAGATCA
GTTTAACACAATATAAGTTCAATGGACTCATAAGGTTAAG
GCCACCAGCATTGTTTTTATAGTGTATTATACTATTAACG
ATACTATTACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations