Transcript

jag2b-202

ID
ZDB-TSCRIPT-090929-554
Name
jag2b-202
Previous Names
  • jag2-002
  • jag2b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000005845 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000005845|OTTDARG00000005397|ZDB-GENE-011128-3 jag2b|OTTDARP00000005229 jag2-002 LG_ BX004766.9 Danio rerio protein_coding KNOWN, 5324 bp
GTGATCAGACCGAGGGAGAGATCAGCACAGACCATCACCG
CGCAAACACACCACGCTCGTGAATTTTTGCATGTCAGGAA
CGGAGGATCCTGTCGCCGGTCATCGGCCGTTTTCCATCTT
GCGTTTATAACACATCAAATCGGCGGCATGTGGAATTGTA
TCAGGATTAGGAATTGGCTCCCAATCGCGTGCCTGCTGTT
AACGATGTGGACGAAGGTGTCCCAGTCCTCTGGCTATTTT
GAGCTGCAGCTGATTGCTGTAGAAAATGTAAACGGTGAGT
TGTGGGACGGGGAATGTTGCGACAGCACGCGGAACTCTCA
AGACCAGCGCTGCGTGCGGGACGAGTGCGATACTTACTTT
AAAGTGTGTCTGAAGGAGTACCAGTCTGAAGTCACCACCA
CTGGACAGTGCACCTTCGGCTCTGGATCTACCGACGTTCT
TGGTGGAAATATAATTTCTTTTAAGACCGCAAAAAACAGC
CCCAGCAAAACGAGCGACGTGGGAAAGATCATCATCCCTT
TTCACTTCGCCTGGCCGCGATCCTACACACTCATCCTTGA
AGCTTGGGACTGGGATAACTCCACTCAGAACAATGGTGAA
GAAAATTTGATCGAACGGCACATTCACGCAAGCATGGTAA
ACCCCGGCGACCACTGGCAGTCCATCCGGCACCCTGGCAT
CACGGCCCACATTGAGTACCGCATCCGTGTCAGGTGTGAT
GAGAATTACTATGGGAGTAAGTGCAACAAACAGTGTCGCC
CACGAGATGACTACTTCGGTCATTACCGATGCGATCCATC
TGGAAATATTGTGTGTCTTGATGGCTGGATGGGAGAGGAC
TGTCGGACAGCGATCTGCAAGCAGGGCTGTAATCTGATTC
ACGGAGGCTGTGCGGTGCCTGGAGAATGCAAGTGCAACTA
CGGCTGGCAGGGGCAGTTCTGCGACGAGTGTCTACCTTAT
CCTGGCTGTTTGCACGGTACCTGTGTTATGCCCTGGCAAT
GCACTTGTGAGAAGAACTGGGGCGGCCTCCTCTGCGATAA
AGATCTGAACTACTGCGGCACGCATCATCCTTGTGTCAAT
GGTGGAACCTGCATGAACTCTGAACCGGATGAATATAACT
GTGCCTGTCCCGAAGGCTACTCTGGCAAGAACTGTGAGAT
AGCTGAACATGCATGCGTATCAAACCCCTGTGCAAACGGA
GGCACGTGTCATGAAGTCCCGACCGGATTCGAGTGCCACT
GTCCACCAGGCTGGGAGGGTCCCACTTGCGCTAAAGACAT
GGATGAATGTGCCTCCAGCCCGTGTGCGCAAGGCGGAACA
TGTATCGACCTGGAAAATGGCTTTGAGTGTGTCTGTCCTC
CGCAGTGGGTTGGAAAGACCTGTCAGATCGATCTCAATGG
CTGCCATGGACAGTGCCAGAATGGAGCTACTTGCAAGGAG
CTGGTTCATGGAGGTTACCACTGTCAGTGTCCTGCGGGGT
TTGTGGGCTTACACTGTGAAGTCTCAAGGAATAAATGTGC
CAGCGGTCCATGTCAGAATGGTGGCCGCTGCCATGTCATT
CTGGACAGCTTCGTTTGTGAGTGTCCGTCAAACTACGCAG
GGATGCTCTGTGAGGTGGAGAGTCTGTCTCACCCAAACCC
ATGTGAGCCGAACCCTTGTCAGAATACAGCTTTGTGCTAC
AGTCTGCCGGGTGACTTTTACTGCGCCTGTCCTGAAGACT
ATGAGGGCAAGACCTGCGAAAACCGCAAGGACCACTGCAA
GATGACCCCTTGCCAAGTGATCGATAGCTGTACCATTGCT
GTGGCGAGTAACAGTTCAGATGGAGGCGTGAGACACATTA
ACTCTAATGTTTGTGGTCCTCATGGCCGCTGTATCAGTCA
GCCGGGTGGAAATTTCACCTGCACCTGTGAGCTTGGCTTT
ACAGGAACCTACTGTCACGAGAATGTAAATGACTGTGTGA
GCAATCCGTGTCGAAATGGAGGCACCTGTATTGACGGGAT
CAGCTCTTTCCAGTGCTTCTGTCCAGATGGCTGGGAAGGA
GACCTTTGCAGCATCAATGTGAACGAGTGCAGTCGGAGCC
CCTGCAAAAATGGCGGGCACTGTGTGGATCTGGTCAATGA
CTTTTACTGTGAATGTGCCAATGGCTGGAAGGGAAAGACC
TGCCATTCACGTGAAAGTCAGTGTGACTCCTCCACATGCA
GTAATGGAGGAACCTGCTATGATCACGGAGATGCTTTCCG
CTGTGCTTGTCCTCCAGGATGGGAAGGAAGTACATGCAAT
ACAGCGAAGAACAGCACTTGCGCGTCCGGCCCCTGTCTGA
ATGGAGGCACGTGTGTGGGTGGCGGAGACACGTTCACCTG
CATCTGTAAAGACGGCTGGGAGGGAGCCACCTGCGCCCAG
AACACCAACGACTGCAACCCTCACCCCTGTTACAATGGAG
GAATCTGTGTGGATGGGGTGAACTGGTTCCGCTGTGAATG
TGCTCCTGGATTTGCAGGACCCGACTGCCGTATCAACATC
GATGAGTGCCAGTCATCCCCCTGCGCCTATGGTGCCACCT
GTGTGGATGAGATCAATGGTTTCCGGTGTGTTTGCCCACT
CGGTCGCACTGGACCTCAATGCCAAGAGTTTATTGGCATT
GGGAAGACGTGCCACTATGCTGGACTTCAGTTCCCACATG
GCAGCCGCTGGGAGGAAGAATGCAACACTTGTCAGTGCGT
CAACGGCAAGGTGGAGTGCACCAAGGTGGTCTGTGGTCGG
AAGCCATGCCTTCTGCCAGGGACCCCAGGGCGAGAGCTTC
ACTACTGTCCAGGAGGTCGTGAATGCCTGGAGCACAACTT
CCTGACATGCCTCTCACCCCCTTGTCACCAATGGGGGTTT
TGTTCAAGCCCTGAGACCCCCCCAACCCTCCAAACCAAAT
GCGAGCCCAACTCGGTCTATCTGGACAAGAGCTGTGCTCG
CATCACCCTTATTTTCAACAGGGACAAACTACCCACAGGA
ACGACGGTGGAGAATGTCTGCTCGGAGCTGAGGTATATGC
CTGCCACGCGGAGCCTGGCAAAGGATCATAAGCTGTTGGT
TCTGTGTGACCTCTCCTACAAAAACCAGGACGCCGTAGAG
GTAGCCATTTCGTTCCAGCAGGATGAGCAGCCCAGTCACA
GTCAAATCCAGGAGGCTGCGAGTACCATCGTCAGCACACT
GTCCAAGCGGCACAACAGCACCGTCATGCTTGCCGTCATC
GAGGTCAAAGTGGAGATGCCGGTCACGTCTCAGCCAGTGG
ATTACCTGGTACCTGTGTTGTGCGTCGTCTTATGCGTCCT
CTGGGTCTTCTGCGTCATCGTCTGTGTATGGTGGACCCGC
AAGCGGAGAAAAGAGCGCGAGAGATGTGAGCGCGTTCCAG
TGGAGGAGAGTGTCAACAACCAGTGGGAACCGCTGAGGCC
TGTGACGCGGCCGCAGCACAAGGACAACCGGGACGCGCAG
TTTGAGCGCACCAAACTCATGGGCTCCCCAGACCGAACCT
GCAACAGCGGGGACGACGAGGAGGACATGGAGGAGGATGA
GCTGGAGCTGGTGGAAGAATGGTGCGGGACGGAAGGAGGC
AAGCATCCCGTCCAAAAGTACTCTAAATCTGCAGCGCGGA
CCAAGAATGGGCTGATCTGCACCACGAGGAGCACCAGCGG
CAGCAGTAGCCCTTCACTCAAAGCAGCCTACTGGACAGGC
TTCAGCCCAAAGGACAACAACTGTAAAAATGTCAATAATG
CCACCGCCGGCCAAGAGCACAAAGAACACTGCGTATGAGC
TCCGATGAGCAGGACGAGGAGACCAAGGCCATCTCAGAAA
CCAAGACTGAGTTTGTTTTTTTTCCCCCATGTGTTGTTTT
ATTTTTGACTCTTTGGAGCGTTTTGAAGCTGAAAAAGTGG
CAAATTTCTTTCCCTTTTTTTTATGTACAGAGGAAGCAGA
CTGTATTTGTTTATAAGGAGGCATCGAGAAGCCTCGTTTT
TGTTTTCGGGAAGAAAAAAAAACTAAACTGCTGGAATGGA
AGCAAGACTAAGGAACTTGCGAATTTTATGTTGTTGTTTA
CAAACATTTGTGCTTTTGATTTCGTTTCGAGTGGCCCAAC
TTCGGTGCAGACCACGTGGGGACAAGCGTTCATCTGTTCT
CCTTCCGCGCCTGCCTTACAGAGCTCGACGTTCACGAGGA
GGGCTAGAGTGCCTATAAAGTGGCCTTGTTTTTTTTTCTG
CCGACTTGGCTGAACGCTCTTTAAACAAACGGATTGCAGT
ATTTTGAGTCGTTCGCAAGTGCCTTCAGACAAGCCCCTCG
GTTTCAGGGTCTCCAGCCCCGGTAGATCACGAAAAACACA
CACACGCACACACACAAAAAATAGGTGGAGAGGCTGGTCC
CAAAAGCAGCTCCCATATAACCATCAAGGTATTTGTTTAA
AGACGAGATCTGTAAATACGTGTAAATAATAAAGGAGTCG
CTGTGTATATTTGAATTTAGTAACTTAAGTCACTTTTTTT
ATTATTATAATTATTATTATTATGATTTAAATATTATGAT
TATTATTGTTTTTTATTTTTATTTTCCACCATTCCTTTTT
ATTTATGCCAGTTGTCATGGCAGGTTTTGTAAGATATACA
GCGTCCCGCAGTCAGAGCAGAAATATAATCAGAGATCATC
CTATTATGTTGTTGTTTTATTTTTGTTTTTCCACTAGACA
CCTATACGATCGTGTGCTGTATTGTGGCGTGTGTGTTCGC
CTCCTTGAAGACCCACAATCCCTTCCCTTACCAGTCCTCC
TGTTGCTGATCATAAAACCGAGACCTGCCGGTTCATGCTT
GTTGCTTGTAAAGATGCTGATATGTCAAAATGATGACTTC
CAAATGCTTTCTGTTTGCTTGTTTGTGTTTGTTTGGATCG
AAACTTTCATGAAGGGAACAATTATGTTGTCAAGCATTTG
TACTCGAGGTACCAGTTCAAAGAAGTGGATTATCTCTGAA
ACGGCTGGCTATGATTTGATTTTGTTCATCATGATGTTCA
ATATAAGACTCCTAGGAAGATGCTAAAAGTTCAAACTGTT
TTGATTGGTTCAAAAATCAGGTTAACGCAAACTAGTAGAA
ATTAAGCTCAATGTTAAGTCCGTTATGGAAGGGAAACTGA
GTGGAGCTGGAGAGGAGAATTTTCTTTGTTTTGTTTTATT
TCTTTTTTAAAGATGTAATTTTTTTGTACAGAAGAATTGC
TCTGAAAAAAGTTCATTTAGTGGAATTTATGTTTGTTCTT
AGAAATAAATCAAACTATTTATTAAAGCATTTTATAACAA
TGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations