Transcript

serpinf2b-202

ID
ZDB-TSCRIPT-121213-182
Name
serpinf2b-202
Previous Names
  • serpinf2b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057478 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057478|OTTDARG00000035855|ZDB-GENE-061215-114 serpinf2b|OTTDARP00000045052 serpinf2b-002 LG_ CU861670.6 Danio rerio protein_coding KNOWN, 623 bp
ATCAATATCAACATTGGCAGTGCTGTCTTGTCATCTCCTC
CTCATTAATTTTTCTAATGCCGCAAGTTTACTCATATTCA
TAGCCTCACATGCACTGTCAGCAGTGAGTTTATTTAGCTA
AGCAAACTAGACAATTCCAATTTATAACTTACTTTGTTCA
AGCTATTCACAGATCCAGCTATCTACACACTTGAGTTTGA
TGTTCGACCTCAAGGTCTCTCAATATTTACATCTATGAAG
AGGGCTGGATCCCACTCCTGGAGATTTGCACGACTAACTT
CTAGAACATGAACTTGTGTTTTCTGGCATTCCTCCTCCTT
TGTTACTCCAAGCAAGGCTGGACGGACGATGTGACTGATC
CAGAGGATGGAGTGGATCCTGTAATTCCTCTCATTCCACT
GACTCCAAGTAAACCCATATCAGATTTGAAGGCCACTCTT
GACCCCACTGTAACAGAAGAACTCACAGTTAATCCAGATG
GCCTGGAAGCAGATCCTCCAACACCAGGTCCCTCTAGTGG
GCAGAAAGAGGGATCGTCGGAGGAAGAGCTTGATACCCTT
TGTGATGGGGACATGACAGGCAAACAGATAAAACGGACCA
TAGGCAACGGCATTATGAAGCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations