Transcript

serpinf2b-201

ID
ZDB-TSCRIPT-110325-2701
Name
serpinf2b-201
Previous Names
  • ch73-297d15.2-001
  • serpinf2b-001
  • zgc:158410-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051097 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051097|OTTDARG00000035855|ZDB-GENE-061215-114 serpinf2b|OTTDARP00000040160 serpinf2b-001 LG_ CU861670.6 Danio rerio protein_coding KNOWN, 1803 bp
GCTAAAGATCAATGAAAGTTGAAATGTAACTGCGTGCTGC
GAGACTGCCAACCCCTACAGACAAGAATTTTCCCGTTGCC
TGTTTTGTGTGTTTCTTTCCCAAATCAGGGCTGGATCCCA
CTCCTGGAGATTTGCACGACTAACTTCTAGAACATGAACT
TGTGTTTTCTGGCATTCCTCCTCCTTTGTTACTCCAAGCA
AGGCTGGACGGACGATGTGACTGATCCAGAGGATGGAGTG
GATCCTGTAATTCCTCTCATTCCACTGACTCCAAGTAAAC
CCATATCAGATTTGAAGGCCACTCTTGACCCCACTGTAAC
AGAAGAACTCACAGTTAATCCAGATGGCCTGGAAGCAGAT
CCTCCAACACCAGGTCCCTCTAGTGGGCAGAAAGAGGGAT
CGTCGGAGGAAGAGCTTGATACCCTTTGTGATGGGGACAT
GACAGGCAAACAGATAAAACGGACCATAGGCAACGGCATT
ATGAAGCTTGGCCTTTTGTTCCTGGAAAACTTGAAGCCTA
GTCCAGATCAACCTAATGTCATCTTTTCTCCTCTTAGCTT
GTCGGTAGCACTCTCACAGCTAGCACTGGGAGCAACGAAT
GATACAGAAGAGCTGCTTCTACATCACCTGCATGCCGATG
CTCTGCCCTGCTATCACACTGCCCTCAGCAGCCTACTGCG
CAACTTCCGCAAAAGGAGCATGCCAATCGCCAGCCGCATC
TATCTGAAAACGGGATTTAAAGCGAAGTCTGACTTTATGG
AAGATTCTCAGAAACTGTATGACTCAGAGCCGGCCACTTT
GACTGATGTTAATGACGTCAATGAATGGGTCAAGAAAGTC
ACAAATGGGCACATCTCAGAGTTTTTGTCCAGCCTGCCTC
CCAGCGCTGTTATGATGCTCATCAATGCTATGCACTACAA
AGGAGAGTGGCTCACACGCTTTGACCCTCATTTCACCTCC
ACTGAGAATTTCTACATAGATGAAAACCAGATTGTTAATG
TGGACATGATGCTTGGGCCAAAGTATCCTCTCAGCGTGTT
CACCCATCATGAGCTTGATGCCCAGGTTGCTCGATTCCCT
TTTAAAGGCGATAGGAGTCTCTTGGTGGTAATGCCAACAT
CTGGACATGTGAACGTGTCAGCCATCGCAGCAAAGCTCAA
TATATCAGATCTTTACAGTCGATTGCCACGAGAAAGAAAC
ATGCAGGTCAAACTACCTAAATTTAAACTCGATTTCAACC
AGGACCTCCAAGAGGCCATGACAAGCATGGGTTTAGGAAA
GCTGTTTAGTCACCCAAAGCTTGATCGCATCACAGAGGTC
CCCTTGTTTGTGTCCAGTGTGCAGCATATGTCCAGCGTTG
AGATAAATGAAGAGGGGGCAGAGGCAGTGGCCGCAACAAG
TGTGGTCATCTCACGTTCCAATCCTTCATTTACTGTCAAC
CAGCCATTTTTCTTTGCCCTGATGGATGATTTGAGTCAAA
CACCATTGTTCCTCGGAGTAATTTCCAATCCAAACCCTGG
AGCATCCACTATGATCACAAACCCTGGCAATGCAGACAAA
ACTGATGACAAGCCTTTTGAGGTTCATCCAAAATAGATTA
TTTTCATGCTCTTACAAAATGAGTCTATAAGCGATTGCTG
ACTATGTAGTCTGTCCCCACTGGGAGGCAGATTTAGTATA
TCTACTTAAAGTAAATTTTTTAAGATCATTTGAAATTACT
ACCCCCTGTATGAATTAATTTTCTAAATGCACTAATCTTG
TTTAAAAATGGTCATGATTTCTTTTTTCTTTCTTTCTTTC
TTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations