header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-698
Transcript Name: myh10-202
Previous Name: ottdart00000054404

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054404 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054404|OTTDARG00000037997|ZDB-GENE-030616-162 myh10|OTTDARP00000042734 myh10-001 LG_none FP017252.5,AL954384.11 Danio rerio protein_coding KNOWN, 7446 bp
GAGTTCGGTTGAGGAGTTCGGAGAAGCGGCGGCGCTGCGG
ACGGTGGCATCAGTGCAAAGGGGCGAAACAAGGGAATATT
TGGCCGACTTTCAAAATAACTGGATTATAAAAACTGGACG
CGCTGGATAGCCACTCATTCATCTCTTCGTGCACGTAGCT
CTCATCTCTGACCGCCCGTGGTGGCCTATTTTTAGTTCCT
CATGCCGGAGATGGCGCAGCGGAGTGGGCAAGAGGACCCT
GAGCGGTACCTCTTTGTGGATCGGGCCGTGGTCTACAACC
CAACTACCCAGGCAGACTGGACGGCCAAGAAGCTGGTGTG
GGTTCCTTCTGAACGGCATGGATTTGAGGCGGCCAGCATC
CGAGAGGAGCGTGGAGAAGAAGTGCTTGTGGAGCTGGCTG
AAAATGGCAAGAAGGCCATGGTGAACAAAGATGACATCCA
GAAGATGAACCCGCCCAAGTTCAGCAAAGTGGAGGATATG
GCTGAACTCACCTGCCTGAACGAAGCATCTGTGTTACACA
ACCTGAAGGATCGTTATTACTCTGGACTCATATACACATA
CTCAGGACTCTTCTGCGTGGTCATAAACCCATACAAAAAC
CTCCCCATATACTCTGAGAACATCATCGAGATGTACAGGG
GCAAGAAGAGGCACGAGATGCCGCCTCATATCTACGCCAT
TTCCGAATCGGCATACAGATGCATGCTTCAAGATCGTGAG
GACCAATCAATTCTTTGCACCGGAGAATCAGGTGCTGGAA
AGACCGAAAACACCAAAAAAGTCATCCAGTACCTGGCTCA
CGTCGCATCATCTCACAAAGGAAGGAAGGACCACAACATT
CCACCAGAATCACCTAAAGCAGTCAAACTCCAGAACGGAA
TCCTGTTTTATGGAGAGTTGGAGCGTCAACTCCTACAGGC
AAATCCTATTCTGGAATCCTTTGGAAATGCCAAAACAGTG
AAAAATGACAACTCTTCACGTTTTGGCAAGTTCATCCGCA
TCAACTTTGATGTAACCGGTTACATTGTGGGGGCCAACAT
TGAAACCTATCTTCTTGAAAAGTCCAGGGCCATTCGCCAA
GCCAAAGATGAACGCACCTTCCACGTCTTCTACCAGCTGT
TGGCCGGTGCTGGAGAACATCTGAGATCTGATCTACTCCT
GGAGGGTTTCAATAGCTACCGCTTCCTCTCCAATGGTAAC
ATTCCCATCCCTGGCCAACAGGACAAGGATAATTTCCAAG
AGACCATGGAAGCCATGCATATTATGAGCTTCAATCATGA
GGAAATCTTATCAATGCTGAAGGTGGTTTCAGCCGTCCTG
CAGTTTGGTAACATTGTGTTCAAGAAGGAGAGAAACACAG
ATCAGGCCTCTATGCCTGAAAACACAGCTGCTCAAAAACT
TTGCCACCTGCTCGGAATGAATGTCATGGAGTTCACTCGT
GCTATCCTGTCTCCAAGAATCAAAGTGGGCAGAGACTACG
TACAGAAAGCCCAAACTAAAGAACAGGCTGACTTTGCAGT
GGAAGCCCTGGCCAAGGCCACTTATGAAAGGTTGTTCCGC
TGGCTTGTTCACCGCATTAATAAAGCTCTGGACAGAACCA
AGCGCCAGGGAGCTTCCTTTATTGGCATCCTGGATATTGC
TGGCTTTGAGATTTTCCAGCTCAACTCATTCGAGCAGCTT
TGTATCAACTACACCAATGAGAAGCTCCAGCAGCTCTTCA
ACCACACCATGTTCATCCTGGAGCAGGAGGAGTATCAGCG
GGAAGGCATCGAATGGAGCTTCATCGACTTCGGCCTCGAC
CTGCAGCCCTGCATTGACCTCATTGAGAGACCCGCAAATC
CTCCTGGCGTGTTGGCTCTGTTGGATGAGGAATGCTGGTT
CCCCAAAGCCACAGATAAAACCTTTGTGGACAAACTTGTT
CAAGAGCAAGGCACCCATGGAAAGTTCCAGAAACCACGGC
AGCTGAAGGACAAAGCCGATTTCTGTATCATTCACTATGC
TGGAAGGGTTGATTATAAGGCTGATGAGTGGTTAATGAAA
AACATGGACCCTCTGAATGACAATGTGGCTACGCTTCTGC
ATCAGTCCACGGATAAGTTTGTGGCTGAGCTGTGGAAGGA
CGTGGACCGTATTGTTGGTTTGGACCAAGTGGCAGGAATG
AATGAGACTGCATTTGGAGCCGCATATAAGACCAAAAAGG
GCATGTTTCGCACTGTGGGTCAACTATATAAAGAGTCCCT
TACAAAACTCATGGCCACACTCCGAAACACCAACCCCAAC
TTTGTTCGCTGTATAATCCCCAATCATGAGAAGAGAGCTG
GTAAGCTGGAGCCCCATCTGGTTCTAGATCAGCTGAGGTG
TAATGGAGTTCTTGAAGGGATCCGCATCTGCAGGCAGGGA
TTCCCTAACCGCATCGTCTTCCAGGAGTTCAGACAGAGAT
ATGAGATTCTTACTCCTAATGCAATACCTAAAGGCTTTAT
GGATGGCAAACAGGCTTGTGAGAGAATGATTCGAGCTTTG
GAGCTCGACCCAAACCTCTACCGCATCGGTCAGAGCAAGA
TCTTCTTCCGCACTGGAGTTTTGGCGCACCTGGAGGAAGA
GAGAGACCTGAAAATAACAGACATCATCATCTACTTTCAG
TCGGTCTGTCGAGGATACCTGGCTCGCAAGGCCTTCGCTA
AAAAGCAGCAGCAGCTAAGTGCTTTGAAAGTCCTCCAGAG
AAACTGCGCTGCTTACCTGAAACTGCGCCACTGGCAGTGG
TGGAGACTCTTCACTAAGGTGAAACCCCTCCTCCAGGTGA
CCCGCCAGGAGGAAGAGATGCAGGCCAAGGATGAGGAGCT
TATTAAAGTGAAGGAGAGGCAGGTTAAAGTGGAAAACGAG
TTGGTAGAAATGGAGAGGAAACACCAGCAGCTCTTGGAAG
AGAAGAACATCTTGGCCGAGCAACTGCAGGCCGAGACTGA
ATTGTTTGCTGAAGCTGAAGAGATGAGGGCTCGTCTGGTG
GCTAAAAAACAAGAGCTGGAGGAGATTCTTCATGACCTGG
AGTCCCGCGTGGAGGAGGAAGAGGAGAGGAACCAGTCGTT
GCAGAACGAGAAGAAGAAAATGCAGTCACACATACAGGAC
CTAGAGGAGCAGCTGGATGAGGAGGAGGCTGCTCGACAGA
AGCTGCAGTTGGAGAAAGTGACTGCTGAAGCCAAGATCAA
AAAGATGGAGGAAGATATTCTGCTGTTGGAGGACCAGAAC
TCCAAATTCCTAAAGGAGAAAAAGCTCCTGGAGGACCGTG
TCGGTGAGATGACCTCTCAGCTGGCTGAGGAAGAAGAGAA
GGCCAAGAACCTCGGCAAAGTCAAAAACAAGCAAGAGATG
ATGATGGTGGACTTGGAAGAGCGTCTGAAGAAAGAGGAGA
AAACTCGACAGGAGCTTGAGAAAGCCAAAAGAAAACTGGA
TGCGGAGACCACAGACCTACAAGACCAGATAGCTGAGCTG
CAGGCCCAGATTGATGAACTTAAGATCCAACTGGCCAAGA
AAGAAGAGGAACTGCAGGCTGTGTTGGCCAGAGGTGATGA
GGAGGTCGCTCAGAAGAACAACGCCCTCAAGCAATTACGG
GAGCTGCAGGCCCAGCTAGCTGAGCTGCAGGAGGATCTGG
AGTCTGAGAAAGCAGCCAGAAACAAAGCAGAGAAGCTTAA
GAGAGATCTGAGCGAGGAACTGGAAGCTCTTAAGACTGAG
CTGGAAGACACGCTGGACACCACCGCTGCCCAGCAGGAGC
TCAGGAGTAAGCGAGAGCAGGAGGTGGCGGAGCTGAAGAA
GGCCATTGACGACGAGACGAGGAACCACGAGTCTCAGATC
CAGGAGATGAGACAGAGGCACGGCACGGCACTGGAGGAGA
TCTCCGAGCAGCTGGAGCAGGCCAAGAGAGTCAAAGGAAA
TCTGGAGAAAAACAAACAGACTCTGGAGAGCGATAATAAG
GAGCTGACCAATGAGGTGAAGAGTTTGCAGCAGGCCAAGT
CTGAGTCCGAACACAAGAGAAAGAAACTGGAGGCTCAGCT
GCAGGAGGTCATGGCCCGCTTCAGTGAGGGGGAGAAGGTT
AAAGGAGAGCTGGCCGACCGTACCCACAAGATACAGACGG
AACTGGACAATGTTTCATGCCTTTTAGAAGATGCCGAGAA
GAAGGGAATCAAACTGACCAAAGACGTCTCCAGTCTAGAG
AGTCAGCTTCAGGATACTCAGGAGTTGCTTCAAGAGGAGA
CGCGTCAGAAGCTGAACCTGAGCAGCCGTATTCGTCAGCT
GGAGGAGGAGAAAAACAATCTTTTGGAGCAGCAGGAGGAG
GAAGAGGAGTCACGAAAGAACCTAGAGAAACAACTGGCAA
CACTACAAGCCCAGCTGGTGGAGACCAAGAAGAAGCTGGA
GGATGATGTTGGAGCCCTTGAGGGTCTGGAGGAGGTCAAG
AGGAAGCTACAGAAGGACATGGAGGTGACCAGTCAGAAGC
TGGAGGAAAAGGCCATTGCTTTTGACAAGCTGGAGAAAAC
CAAGAATAGGCTGCAGCAGGAGCTGGATGACCTCATGGTG
GACCTAGACCATCAGAGACAGATCGTCTCAAACCTAGAGA
AGAAACAGAAGAAGTTTGACCAGATGCTGGCGGAGGAGAA
GACCATCTCTGCGCGTTACGCTGAGGAGCGGGACCGTGCC
GAGGCCGAGGCTCGAGAGAAGGACACCAAAGCTCTGTCTA
TGGCCCGAGCCCTGGATGAAGCTCTGGAGGCTAAAGAGGA
ATTCGAGAGACTCAACAAGCAGCTCAGAGCTGAGATGGAG
GATCTGATCAGCTCCAAGGATGACGTAGGCAAAAACGTCC
ACGAGCTGGAGAAATCTAAGCGGACTCTGGAGCAGCAGGT
GGAGGAGATGCGCACTCAGCTGGAGGAGCTGGAGGACGAG
CTGCAGGCCACTGAAGATGCCAAGCTGCGTCTGGAGGTCA
ACATGCAGGCCATGAAGGCCCAGTTTGACCGAGACCTGCA
GGCCAGAGATGAGCAGAACGAGGAGAAGAAGAGGGCGCTG
GTTAAACAGGTGCGTGAGATGGAAGCAGAGCTGGAAGATG
AGAGGAAGCAGAGAGCTCTTGCTGTTGCTGCAAAGAAGAA
GCTGGAGATGGACCTGAAAGATGTGGAAGCTCAGATTGAG
GCTGCAAACAAGGCCCGCGATGAAGCCATCAAACAACTAC
GAAAACTCCAGGCTCAGATGAAGGACTACCAGAGGGAGCT
GGAGGAGGCACGCACTTCACGAGACGAGATCTTCACTCAG
TCTAAAGAGAACGAGAAGAAGCTCAAGAGTCTTGAGGCTG
AGATTCTGCAGTTGCAAGAGGATCTGGCATCTTCAGAGAG
AGCCAGACGCCACGCTGAGCAGGAAAGAGATGAACTTGCT
GATGAGATCTCCAACAGCGCCTCTGGAAAGGCAGCCCTGT
TGGATGAGAAGAGGAGACTGGAGGCTCGTATCGCTCAGCT
GGAGGAAGAGCTGGAGGAGGAACAGAGCAATATGGAGCTC
CTGAACGACCGCTTCCGCAAGACCACTATGCAGGTGGACA
CCCTGAACACAGAGCTGGCAGGAGAGCGCAGCGCTGCACA
GAAGAGTGAGAACGCACGTCAGCAGCTCGAGCGCCAGAAC
AAGGACTTAAAATCCAAGCTGCAGGAACTCGAGGGATCCG
TCAAATCAAAGTTCAAGGCCTCTATCGCCGCCCTGGAGGC
AAAGATCCTCCAGCTAGAGGAGCAGCTCGAACAGGAAGCA
AAGGAAAGAGCTGCAGCTAATAAGATTGTGCGTCGCACAG
AGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGACGA
GCGGCGCCATGCAGACCAGTATAAAGAACAGATGGAAAAG
GCCAACTCGCGCATGAAGCAGCTGAAGAGGCAGCTGGAGG
AGGCTGAGGAGGAGGCGACGCGAGCAAACGCCTCCCGCAG
GAAACTGCAGAGAGAGCTGGATGACGCCACTGAAGCCAGC
GAGGGGCTGAGCCGAGAGGTCAACACACTCAAGAACAGAC
TCAGACGTGGCGGTCCAGTGAGCTTCTCCTCCAGTCGTTC
AGGACGCAGGCAACTGCAGATGGAGGGAGACTTCTCTGAC
GACGACGCAGACAGCAAAGCCAGCGATCTGAACGAGAACC
AGCCTCCTCCAGCAGAATAACATAACACACCCTTCATCAA
CACCTCATTCTGCTCCTGCAGCTCTCCGTGGTACACAAAC
ACACACACACACTCAGTCAGAAGCTACATCTCCATCAACT
CTGCCTTATTCCCAATTCAAGATGCTTCAAGACCCATTAG
TGTTTTCCTGTAGCCTTCCACGACACTATAGAAGTGCATT
TGCTCCGCTCATTCGGTCAAAACGGTCACTCCAATCTAGT
TTAGCTAGCTAAGCCAACGTGACGGATCGCATCTTAGTTG
TACAGTTCAGAATTTCGGGCTCGGTTGAGATGCATGTGCT
GCTCGTTCGCTTTAAAAGCAACTAAATCAAGTCCTATGGC
TCGAAATAAATGTGAAACCACTACATCTCGTCACCGGGCT
TCGTAATTTGGGCTTGGCTTCACTCGAGGCCTCCTGTTTG
GGAGATGTTTTACGAAATTTGACGTAACTGCGAATCGCTT
TTAACTGCACATCATTTGAGAAGCCATGCAACTGGAAACC
AATATGACGTTTTCTGGATGCACGTCAAGCATTACAAGCC
TTTACCTATATATATATAATCTATTTAGGTTTCCCCCCCT
ATATGTGACACAATGATGGTACATCCCAAATCCAGCTGCT
CTATTTGATACACTACATGTGAATCACGGCCACTAGAGGA
AGTGTATGGAGGAAGACGTTTGAGACACTAACGTCTAGAT
TGGATTCGTCAACTGGAACACGTTCATTCACAGCTACTTC
CTTAAAGACTTGAGTTTAGGGATGATTTGAACAATAGATG
AATGGAAAGTGTACTAACCTGTTAGCATTTAATGACGTGT
TTCTTAAAGTGCCTTAGACACTAACTAGAAAACATCCATG
AGAGTTTGTCATGAAGAAACGCTAACATGAAGGTAAAAGC
GGATGAAGGAAATTGGAATAAAACTGTTATGTAACCTCCT
CCCCCCTATTTTTTTTTGTTGTATTTTACCGTGGTATGAT
CATATCCAGTATATCAGTCTCCTGTATTTGAGGATGATCT
GGGGAATCAGTGTTAATGATGGTTTGCTATAGAAGTGAAG
AGAACTCATTTGGTTTAAAGCTTTATCATATCATCATCAT
CATCATCATCTTTATTATTATTAATGCGGTATTATTATTA
TCACTTCTGTTGTTGGCGAGCAGACGTCTCTCCTCTTGTT
TTTCCTCTTGTATACTGTAACTATTTCTAGATGACAGTGA
GTTTTGTAAAGGAAAAAACAATAAATAAAAGGTTGATTGT
AGAAGA

myh10 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA myh10-001 (1) 3197
ncRNA myh10-003 (1) 509
mRNA myh10-201 (1) 7428
myh10-202 7446
ottdart00000001857 (1) 507
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myh10-202 Contained in:

OTHER myh10-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054404 (1)
  • Ensembl_Trans:ENSDART00000151114 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT658612 (1) 847bp
    GenBank:CT703408 (1) 813bp
    GenBank:CK680439 (1) 776bp
    GenBank:CT586836 (1) 772bp
    GenBank:CT635912 (1) 745bp
    GenBank:BM775979 (1) 652bp
    GenBank:AY934530 (1) 642bp
    GenBank:EB933301 (1) 552bp
    GenBank:CR930764 (1) 539bp
    GenBank:CB356308 (1) 537bp
    GenBank:EB940484 (1) 430bp
    GenBank:EB773636 (1) 311bp
    CITATIONS (2)