ZFIN ID: ZDB-TSCRIPT-120213-313
Transcript Name: myh10-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054403 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054403|OTTDARG00000037997|ZDB-GENE-030616-162 myh10|OTTDARP00000042733 myh10-002 LG_none FP017252.5,AL954384.11 Danio rerio protein_coding KNOWN, 7428 bp
GAGTTCGGTTGAGGAGTTCGGAGAAGCGGCGGCGCTGCGG
ACGGTGGCATCAGTGCAAAGGGGCGAAACAAGGGAATATT
TGGCCGACTTTCAAAATAACTGGATTATAAAAACTGGACG
CGCTGGATAGCCACTCATTCATCTCTTCGTGCACGTAGCT
CTCATCTCTGACCGCCCGTGGTGGCCTATTTTTAGTTCCT
CATGCCGGAGATGGCGCAGCGGAGTGGGCAAGAGGACCCT
GAGCGGTACCTCTTTGTGGATCGGGCCGTGGTCTACAACC
CAACTACCCAGGCAGACTGGACGGCCAAGAAGCTGGTGTG
GGTTCCTTCTGAACGGCATGGATTTGAGGCGGCCAGCATC
CGAGAGGAGCGTGGAGAAGAAGTGCTTGTGGAGCTGGCTG
AAAATGGCAAGAAGGCCATGGTGAACAAAGATGACATCCA
GAAGATGAACCCGCCCAAGTTCAGCAAAGTGGAGGATATG
GCTGAACTCACCTGCCTGAACGAAGCATCTGTGTTACACA
ACCTGAAGGATCGTTATTACTCTGGACTCATATACACATA
CTCAGGACTCTTCTGCGTGGTCATAAACCCATACAAAAAC
CTCCCCATATACTCTGAGAACATCATCGAGATGTACAGGG
GCAAGAAGAGGCACGAGATGCCGCCTCATATCTACGCCAT
TTCCGAATCGGCATACAGATGCATGCTTCAAGATCGTGAG
GACCAATCAATTCTTTGCACCGGAGAATCAGGTGCTGGAA
AGACCGAAAACACCAAAAAAGTCATCCAGTACCTGGCTCA
CGTCGCATCATCTCACAAAGGAAGGAAGGACCACAACATT
CCACCAGAATCACCTAAAGCAGTCAAACTCCAGGGAGAGT
TGGAGCGTCAACTCCTACAGGCAAATCCTATTCTGGAATC
CTTTGGAAATGCCAAAACAGTGAAAAATGACAACTCTTCA
CGTTTTGGCAAGTTCATCCGCATCAACTTTGATGTAACCG
GTTACATTGTGGGGGCCAACATTGAAACCTATCTTCTTGA
AAAGTCCAGGGCCATTCGCCAAGCCAAAGATGAACGCACC
TTCCACGTCTTCTACCAGCTGTTGGCCGGTGCTGGAGAAC
ATCTGAGATCTGATCTACTCCTGGAGGGTTTCAATAGCTA
CCGCTTCCTCTCCAATGGTAACATTCCCATCCCTGGCCAA
CAGGACAAGGATAATTTCCAAGAGACCATGGAAGCCATGC
ATATTATGAGCTTCAATCATGAGGAAATCTTATCAATGCT
GAAGGTGGTTTCAGCCGTCCTGCAGTTTGGTAACATTGTG
TTCAAGAAGGAGAGAAACACAGATCAGGCCTCTATGCCTG
AAAACACAGCTGCTCAAAAACTTTGCCACCTGCTCGGAAT
GAATGTCATGGAGTTCACTCGTGCTATCCTGTCTCCAAGA
ATCAAAGTGGGCAGAGACTACGTACAGAAAGCCCAAACTA
AAGAACAGGCTGACTTTGCAGTGGAAGCCCTGGCCAAGGC
CACTTATGAAAGGTTGTTCCGCTGGCTTGTTCACCGCATT
AATAAAGCTCTGGACAGAACCAAGCGCCAGGGAGCTTCCT
TTATTGGCATCCTGGATATTGCTGGCTTTGAGATTTTCCA
GCTCAACTCATTCGAGCAGCTTTGTATCAACTACACCAAT
GAGAAGCTCCAGCAGCTCTTCAACCACACCATGTTCATCC
TGGAGCAGGAGGAGTATCAGCGGGAAGGCATCGAATGGAG
CTTCATCGACTTCGGCCTCGACCTGCAGCCCTGCATTGAC
CTCATTGAGAGACCCGCAAATCCTCCTGGCGTGTTGGCTC
TGTTGGATGAGGAATGCTGGTTCCCCAAAGCCACAGATAA
AACCTTTGTGGACAAACTTGTTCAAGAGCAAGGCACCCAT
GGAAAGTTCCAGAAACCACGGCAGCTGAAGGACAAAGCCG
ATTTCTGTATCATTCACTATGCTGGAAGGGTTGATTATAA
GGCTGATGAGTGGTTAATGAAAAACATGGACCCTCTGAAT
GACAATGTGGCTACGCTTCTGCATCAGTCCACGGATAAGT
TTGTGGCTGAGCTGTGGAAGGACGTGGACCGTATTGTTGG
TTTGGACCAAGTGGCAGGAATGAATGAGACTGCATTTGGA
GCCGCATATAAGACCAAAAAGGGCATGTTTCGCACTGTGG
GTCAACTATATAAAGAGTCCCTTACAAAACTCATGGCCAC
ACTCCGAAACACCAACCCCAACTTTGTTCGCTGTATAATC
CCCAATCATGAGAAGAGAGCTGGTAAGCTGGAGCCCCATC
TGGTTCTAGATCAGCTGAGGTGTAATGGAGTTCTTGAAGG
GATCCGCATCTGCAGGCAGGGATTCCCTAACCGCATCGTC
TTCCAGGAGTTCAGACAGAGATATGAGATTCTTACTCCTA
ATGCAATACCTAAAGGCTTTATGGATGGCAAACAGGCTTG
TGAGAGAATGATTCGAGCTTTGGAGCTCGACCCAAACCTC
TACCGCATCGGTCAGAGCAAGATCTTCTTCCGCACTGGAG
TTTTGGCGCACCTGGAGGAAGAGAGAGACCTGAAAATAAC
AGACATCATCATCTACTTTCAGTCGGTCTGTCGAGGATAC
CTGGCTCGCAAGGCCTTCGCTAAAAAGCAGCAGCAGCTAA
GTGCTTTGAAAGTCCTCCAGAGAAACTGCGCTGCTTACCT
GAAACTGCGCCACTGGCAGTGGTGGAGACTCTTCACTAAG
GTGAAACCCCTCCTCCAGGTGACCCGCCAGGAGGAAGAGA
TGCAGGCCAAGGATGAGGAGCTTATTAAAGTGAAGGAGAG
GCAGGTTAAAGTGGAAAACGAGTTGGTAGAAATGGAGAGG
AAACACCAGCAGCTCTTGGAAGAGAAGAACATCTTGGCCG
AGCAACTGCAGGCCGAGACTGAATTGTTTGCTGAAGCTGA
AGAGATGAGGGCTCGTCTGGTGGCTAAAAAACAAGAGCTG
GAGGAGATTCTTCATGACCTGGAGTCCCGCGTGGAGGAGG
AAGAGGAGAGGAACCAGTCGTTGCAGAACGAGAAGAAGAA
AATGCAGTCACACATACAGGACCTAGAGGAGCAGCTGGAT
GAGGAGGAGGCTGCTCGACAGAAGCTGCAGTTGGAGAAAG
TGACTGCTGAAGCCAAGATCAAAAAGATGGAGGAAGATAT
TCTGCTGTTGGAGGACCAGAACTCCAAATTCCTAAAGGAG
AAAAAGCTCCTGGAGGACCGTGTCGGTGAGATGACCTCTC
AGCTGGCTGAGGAAGAAGAGAAGGCCAAGAACCTCGGCAA
AGTCAAAAACAAGCAAGAGATGATGATGGTGGACTTGGAA
GAGCGTCTGAAGAAAGAGGAGAAAACTCGACAGGAGCTTG
AGAAAGCCAAAAGAAAACTGGATGCGGAGACCACAGACCT
ACAAGACCAGATAGCTGAGCTGCAGGCCCAGATTGATGAA
CTTAAGATCCAACTGGCCAAGAAAGAAGAGGAACTGCAGG
CTGTGTTGGCCAGAGGTGATGAGGAGGTCGCTCAGAAGAA
CAACGCCCTCAAGCAATTACGGGAGCTGCAGGCCCAGCTA
GCTGAGCTGCAGGAGGATCTGGAGTCTGAGAAAGCAGCCA
GAAACAAAGCAGAGAAGCTTAAGAGAGATCTGAGCGAGGA
ACTGGAAGCTCTTAAGACTGAGCTGGAAGACACGCTGGAC
ACCACCGCTGCCCAGCAGGAGCTCAGGAGTAAGCGAGAGC
AGGAGGTGGCGGAGCTGAAGAAGGCCATTGACGACGAGAC
GAGGAACCACGAGTCTCAGATCCAGGAGATGAGACAGAGG
CACGGCACGGCACTGGAGGAGATCTCCGAGCAGCTGGAGC
AGGCCAAGAGAGTCAAAGGAAATCTGGAGAAAAACAAACA
GACTCTGGAGAGCGATAATAAGGAGCTGACCAATGAGGTG
AAGAGTTTGCAGCAGGCCAAGTCTGAGTCCGAACACAAGA
GAAAGAAACTGGAGGCTCAGCTGCAGGAGGTCATGGCCCG
CTTCAGTGAGGGGGAGAAGGTTAAAGGAGAGCTGGCCGAC
CGTACCCACAAGATACAGACGGAACTGGACAATGTTTCAT
GCCTTTTAGAAGATGCCGAGAAGAAGGGAATCAAACTGAC
CAAAGACGTCTCCAGTCTAGAGAGTCAGCTTCAGGATACT
CAGGAGTTGCTTCAAGAGGAGACGCGTCAGAAGCTGAACC
TGAGCAGCCGTATTCGTCAGCTGGAGGAGGAGAAAAACAA
TCTTTTGGAGCAGCAGGAGGAGGAAGAGGAGTCACGAAAG
AACCTAGAGAAACAACTGGCAACACTACAAGCCCAGCTGG
TGGAGACCAAGAAGAAGCTGGAGGATGATGTTGGAGCCCT
TGAGGGTCTGGAGGAGGTCAAGAGGAAGCTACAGAAGGAC
ATGGAGGTGACCAGTCAGAAGCTGGAGGAAAAGGCCATTG
CTTTTGACAAGCTGGAGAAAACCAAGAATAGGCTGCAGCA
GGAGCTGGATGACCTCATGGTGGACCTAGACCATCAGAGA
CAGATCGTCTCAAACCTAGAGAAGAAACAGAAGAAGTTTG
ACCAGATGCTGGCGGAGGAGAAGACCATCTCTGCGCGTTA
CGCTGAGGAGCGGGACCGTGCCGAGGCCGAGGCTCGAGAG
AAGGACACCAAAGCTCTGTCTATGGCCCGAGCCCTGGATG
AAGCTCTGGAGGCTAAAGAGGAATTCGAGAGACTCAACAA
GCAGCTCAGAGCTGAGATGGAGGATCTGATCAGCTCCAAG
GATGACGTAGGCAAAAACGTCCACGAGCTGGAGAAATCTA
AGCGGACTCTGGAGCAGCAGGTGGAGGAGATGCGCACTCA
GCTGGAGGAGCTGGAGGACGAGCTGCAGGCCACTGAAGAT
GCCAAGCTGCGTCTGGAGGTCAACATGCAGGCCATGAAGG
CCCAGTTTGACCGAGACCTGCAGGCCAGAGATGAGCAGAA
CGAGGAGAAGAAGAGGGCGCTGGTTAAACAGGTGCGTGAG
ATGGAAGCAGAGCTGGAAGATGAGAGGAAGCAGAGAGCTC
TTGCTGTTGCTGCAAAGAAGAAGCTGGAGATGGACCTGAA
AGATGTGGAAGCTCAGATTGAGGCTGCAAACAAGGCCCGC
GATGAAGCCATCAAACAACTACGAAAACTCCAGGCTCAGA
TGAAGGACTACCAGAGGGAGCTGGAGGAGGCACGCACTTC
ACGAGACGAGATCTTCACTCAGTCTAAAGAGAACGAGAAG
AAGCTCAAGAGTCTTGAGGCTGAGATTCTGCAGTTGCAAG
AGGATCTGGCATCTTCAGAGAGAGCCAGACGCCACGCTGA
GCAGGAAAGAGATGAACTTGCTGATGAGATCTCCAACAGC
GCCTCTGGAAAGGCAGCCCTGTTGGATGAGAAGAGGAGAC
TGGAGGCTCGTATCGCTCAGCTGGAGGAAGAGCTGGAGGA
GGAACAGAGCAATATGGAGCTCCTGAACGACCGCTTCCGC
AAGACCACTATGCAGGTGGACACCCTGAACACAGAGCTGG
CAGGAGAGCGCAGCGCTGCACAGAAGAGTGAGAACGCACG
TCAGCAGCTCGAGCGCCAGAACAAGGACTTAAAATCCAAG
CTGCAGGAACTCGAGGGATCCGTCAAATCAAAGTTCAAGG
CCTCTATCGCCGCCCTGGAGGCAAAGATCCTCCAGCTAGA
GGAGCAGCTCGAACAGGAAGCAAAGGAAAGAGCTGCAGCT
AATAAGATTGTGCGTCGCACAGAGAAGAAGCTGAAGGAGG
TGTTCATGCAGGTGGAGGACGAGCGGCGCCATGCAGACCA
GTATAAAGAACAGATGGAAAAGGCCAACTCGCGCATGAAG
CAGCTGAAGAGGCAGCTGGAGGAGGCTGAGGAGGAGGCGA
CGCGAGCAAACGCCTCCCGCAGGAAACTGCAGAGAGAGCT
GGATGACGCCACTGAAGCCAGCGAGGGGCTGAGCCGAGAG
GTCAACACACTCAAGAACAGACTCAGACGTGGCGGTCCAG
TGAGCTTCTCCTCCAGTCGTTCAGGACGCAGGCAACTGCA
GATGGAGGGAGACTTCTCTGACGACGACGCAGACAGCAAA
GCCAGCGATCTGAACGAGAACCAGCCTCCTCCAGCAGAAT
AACATAACACACCCTTCATCAACACCTCATTCTGCTCCTG
CAGCTCTCCGTGGTACACAAACACACACACACACTCAGTC
AGAAGCTACATCTCCATCAACTCTGCCTTATTCCCAATTC
AAGATGCTTCAAGACCCATTAGTGTTTTCCTGTAGCCTTC
CACGACACTATAGAAGTGCATTTGCTCCGCTCATTCGGTC
AAAACGGTCACTCCAATCTAGTTTAGCTAGCTAAGCCAAC
GTGACGGATCGCATCTTAGTTGTACAGTTCAGAATTTCGG
GCTCGGTTGAGATGCATGTGCTGCTCGTTCGCTTTAAAAG
CAACTAAATCAAGTCCTATGGCTCGAAATAAATGTGAAAC
CACTACATCTCGTCACCGGGCTTCGTAATTTGGGCTTGGC
TTCACTCGAGGCCTCCTGTTTGGGAGATGTTTTACGAAAT
TTGACGTAACTGCGAATCGCTTTTAACTGCACATCATTTG
AGAAGCCATGCAACTGGAAACCAATATGACGTTTTCTGGA
TGCACGTCAAGCATTACAAGCCTTTACCTATATATATATA
ATCTATTTAGGTTTCCCCCCCTATATGTGACACAATGATG
GTACATCCCAAATCCAGCTGCTCTATTTGATACACTACAT
GTGAATCACGGCCACTAGAGGAAGTGTATGGAGGAAGACG
TTTGAGACACTAACGTCTAGATTGGATTCGTCAACTGGAA
CACGTTCATTCACAGCTACTTCCTTAAAGACTTGAGTTTA
GGGATGATTTGAACAATAGATGAATGGAAAGTGTACTAAC
CTGTTAGCATTTAATGACGTGTTTCTTAAAGTGCCTTAGA
CACTAACTAGAAAACATCCATGAGAGTTTGTCATGAAGAA
ACGCTAACATGAAGGTAAAAGCGGATGAAGGAAATTGGAA
TAAAACTGTTATGTAACCTCCTCCCCCCTATTTTTTTTTG
TTGTATTTTACCGTGGTATGATCATATCCAGTATATCAGT
CTCCTGTATTTGAGGATGATCTGGGGAATCAGTGTTAATG
ATGGTTTGCTATAGAAGTGAAGAGAACTCATTTGGTTTAA
AGCTTTATCATATCATCATCATCATCATCATCTTTATTAT
TATTAATGCGGTATTATTATTATCACTTCTGTTGTTGGCG
AGCAGACGTCTCTCCTCTTGTTTTTCCTCTTGTATACTGT
AACTATTTCTAGATGACAGTGAGTTTTGTAAAGGAAAAAA
CAATAAATAAAAGGTTGATTGTAGAAGA

myh10 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA myh10-001 (1) 3197
myh10-002 7428
ncRNA myh10-003 (1) 509
mRNA ottdart00000001857 (1) 507
ottdart00000054404 (1) 7446
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myh10-002 Contained in:
OTHER myh10-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054403 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL925508 (1) 532bp
    CITATIONS (1)