header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-1084
Transcript Name: myh10-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054405 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054405|OTTDARG00000037997|ZDB-GENE-030616-162 myh10|no_translation myh10-003 LG_none FP017252.5,AL954384.11 Danio rerio protein_coding KNOWN, 509 bp
ATACAACTAAGATCTGCTTGCTTTGACACATTATTTAAAA
TATGTGGCCAGGATATTATTTATTTTTGCTGGGCCATTAA
AGCAAATCCTTTGTGTTTAGCCGGGTATAAGTTTAAAATG
TCATCTTTATGGTCTTAAAAAGCTCTTAAAGTCTTACATT
TGACTTGGTGAAACCTGCAGAAAGCCTGGTTTAGGTATTG
TGCAGTTTTCATCTGTAATAAAGTCAGATTATTGAACAAT
GACATGAACAAGCATTTGTGCTTGTTTTTGTTCAGGGCAG
CCCTGTTGGATGAGAAGAGGAGACTGGAGGCTCGTATCGC
TCAGCTGGAGGAAGAGCTGGAGGAGGAACAGAGCAATATG
GAGCTCCTGAACGACCGCTTCCGCAAGACCACTATGCAGG
TGGACACCCTGAACACAGAGCTGGCAGGAGAGCGCAGCGC
TGCACAGAAGAGTGAGAACGCACGTCAGCAGCTCGAGCGC
CAGAACAAGGACTTAAAATCCAAGCTGCA

myh10 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA myh10-003 509
mRNA myh10-201 (1) 7428
myh10-202 (1) 7446
ottdart00000001857 (1) 507
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myh10-003 Contained in:

OTHER myh10-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054405 (1)
  • Ensembl_Trans:ENSDART00000151635 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AI558725 (1) 509 bp
    CITATIONS (2)