ZFIN ID: ZDB-TSCRIPT-120213-1085
Transcript Name: rpsa-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054408 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054408|OTTDARG00000019726|ZDB-GENE-040426-811 rpsa|OTTDARP00000042737 rpsa-002 LG_none AL954384.11,CR925711.7 Danio rerio protein_coding KNOWN, 410 bp
GGAGTTTGATAGCAACCTGAGCTACATTTATCCCAACTCA
ACCTACAAACACCCATTTATTTTACTCCCAACTTACACAT
CTGTGTCTTTTTTTTCTTTAGCTTTTCCACTAAACTCGTT
ACGCAGGGAAAGTGGTCACGATGTCCGGAGGTCTGGATGT
CCTTCAAATGAAGGAGGAGGATGTGCTGAAGTTCCTGGCC
GCAGGAACCCATCTGGGAGGAACCAACCTGGACTTCCAGA
TGGAGCAGTATGTCTACAAGAGAAAGAGTGACGGCGTGTA
CATCATCAACCTTAAAAAGACCTGGGAGAAGCTGCTGTTG
GCTGCTCGTGCCATTGTTGCCATCGAGAATCCAGCTGATG
TTTGCGTTATCTCCTCCAGAAACACTGGCCAGAGAGCTGT
GCTGAAGTTT

rpsa TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rpsa-001 (1) 2351
rpsa-002 410
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpsa-002 Contained in:
OTHER rpsa-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054408 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT635281 (1) 406bp
    CITATIONS (1)