ZFIN ID: ZDB-TSCRIPT-090929-7209
Transcript Name: rpsa-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024341 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024341|OTTDARG00000019726|ZDB-GENE-040426-811 rpsa|OTTDARP00000020115 rpsa-001 LG_none AL954384.11,CR925711.7 Danio rerio protein_coding KNOWN, 2351 bp
CTCTTTTTGCCGTGAGGTGCAGAACTCCATACGGCGTTGT
CTCGTGCTTTTCCACTAAACTCGTTACGCAGGGAAAGTGG
TCACGATGTCCGGAGGTCTGGATGTCCTTCAAATGAAGGA
GGAGGATGTGCTGAAGTTCCTGGCCGCAGGAACCCATCTG
GGAGGAACCAACCTGGACTTCCAGATGGAGCAGTATGTCT
ACAAGAGAAAGAGTGACGGCGTGTACATCATCAACCTTAA
AAAGACCTGGGAGAAGCTGCTGTTGGCTGCTCGTGCCATT
GTTGCCATCGAGAATCCAGCTGATGTTTGCGTTATCTCCT
CCAGAAACACTGGCCAGAGAGCTGTGCTGAAGTTTGCCTC
TGCCACTGGCTCGACCACCTTCGCTGGTCGTTTCACTCCT
GGAACCTTCACCAATCAGATTCAGGCTGCTTTCAGAGAGC
CTCGTCTCCTGATCGTGACTGATCCTCGCGCTGACCACCA
GCCCCTGACTGAAGCCTCTTACGTCAACATCCCAACCATT
GCCCTCTGCAACACAGACTCTCCTCTGAGATACGTCGACA
TTGCCATCCCATGCAACAACAAGGGTCCCCACTCAGTGGG
TCTGATGTGGTGGATGTTGGCCAGGGAGGTGCTGAGGATG
AGAGGTACCATCTCCAGAGAGCACCCATGGGAGGTCATGC
CTGATCTGTACTTCTACAGAGATCCTGAGGAGATTGAGAA
GGAAGAGCAGGCCGCTGCTGAGAAGGCTGTTGGCAAGGAG
GAGTTCCAGGGTGAATGGACCGCCCCTGTGCCCGACTTCA
ACCAGCCTGAGGTTGCTGACTGGTCTGAAGGTGTCCAGGT
TCCATCCGTGCCCATCCAGCAGTTCCCAGCTGGCATTGAG
GCTCCTGGCAAGCCTGCGCCTGCTGAGGTGTATGCAGAGG
ACTGGAGCGCTCAGCCTGCCACTGAGGATTGGTCAGCTGC
TCCCACAGCTCAGGCCGGAGACTGGGGCGGAGCCACCGCA
GACTGGTCTTAAGTGAAGCGTTAGCCTGGTGTGATGCTTG
GAAATCAATAAATTTGATTTGTCTAAATTTTGCCTCTTTT
GCATTAATTGAACATCTTTAGTAGTGGAATCTGTGCTGTA
ATATTACCTGCAGCAGTGAATAAGTCGCATCAAAAGAGAT
CTGTAGCTCCTAAAGTTTCTGTCATATTTGCATATAAAAG
CATGTTTGTTTTGTTTTTTATAGTACAATGCATAAATACT
TCTGCATTTTTCAGGGTTCCTGCGGGGTCTTAAAGTCTGA
AACTTCACTAACAATTTTAGGCCTTAAAGTCTTAAATTTA
CTGAAATATTGTCTTGTAGGCCTTAAATCATTTTAAACGG
GTCTAAATTTTTCTCTGTCCAAGTAAAGGTTCCCAATTGA
GCTGACATCAATGCAGTCAACAACAATCCATCTCAACCCT
TTGAGATATATATTTTATTTTTATATATGTTTAAAAAAAA
ATTATTGCAAAGAATTTCAATTTACAATAGCTGTTTGACT
TTTTTACAGTAATTTCTCTAAATTAAATTAAAGAACTAAA
AACAATTGCACTTCCTCATGATAATAACGGAGCAATACTT
TAAATGAAACATTACTCAGTTTGGAGCAAAAGCCAACATA
TGTATATTTGATTGTCATTGTCTCCATTTTAAATAAGCTT
TTTACGATGTTAAACTTGTCATTTAAAAAACATTAGTATT
GTTTTGAAACGAGTTTTTATTTTATTTTAACATGTCGCTA
AGACATAATTGCATTTATATTTATTCACAACCAACCAGGC
TATTAAAAATTAGTGGTCCTTGTACAAGTCTAAAATTGAA
TTCATAATGGTCTTAAAAAGGTTCTAAATTTGACGAATAA
ACCTGCAGAAACCCTGATTTCTTGACATTTTTCATTTGGT
TATTTAGAGCGCTTTATTGGATTATAGAGCACACGGTACA
GTTTTGTATTTTAATACATTTTTCTTACAATGATCTCTGG
GAAGCATTCTTCATGAACTAGCTGCTGAAAAGATGGCACT
AATGCATTGCATTGACTGATAGCAGTGGGTAAGACTGTCT
GTAATGCTGCTTTTACATTGAAAACAGATTTTAATCTTAA
AGTTTCTGATTTATGTAAAAAAAACCTATTGAGAGACAAT
ATTTCACTCCTGTTACTGTTGACAGTTTTACGTCATACCA
ATTCACTTAGTTTCTTTTGCGTTTGGCATCATTTTTAAAA
AAAGATCTAAATACAAGTAGCTACCATTTCAAACAGTACT
TAAGATCAAGTGCATTTGAGCTTTTTGGATTCTGGTAAGA
TCCTGTATATATAGTCAGTTCATCAAACAAA

rpsa TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rpsa-001 2351
rpsa-002 (1) 410
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpsa-001 Contained in:
OTHER rpsa-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024341 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC044504 (1) 1126bp
    GenBank:BC062859 (1) 1073bp
    GenBank:AY391434 (1) 1063bp
    GenBank:CT614694 (1) 628bp
    GenBank:CT708230 (1) 604bp
    GenBank:DY562021 (1) 590bp
    GenBank:CF103145 (1) 574bp
    GenBank:BI884319 (1) 543bp
    GenBank:AI330494 (1) 493bp
    GenBank:AW233549 (1) 424bp
    CITATIONS (1)