Transcript

lrrfip1a-202

ID
ZDB-TSCRIPT-110912-811
Name
lrrfip1a-202
Previous Names
  • ottdart00000052028
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052028 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052028|OTTDARG00000029432|ZDB-GENE-030131-99 lrrfip1a|OTTDARP00000047938 lrrfip1a-003 LG_none CR545476.14,CT867952.9 Danio rerio protein_coding KNOWN, 1810 bp
CTATGATTAAAAATAGTGGAGGGGGTGTGCGAGCCCTGAA
ACTCCCCCAACAGACGCTCGAGTCCATCTGTGCACCAACA
GTGAACTAAAGCGAGAGAAGAAAACTTTTAACCCAGCAGT
TACACTAACACTGCATAAATACCAAACTCTGTGCAAACAA
ACTTTAACTGTTAGACCATTTACAGCCATTTTGGCAACTT
CTCGGTGGCGACACGTGTGTCATGAAAACGCGTTTGCGCT
CTCAGTAACGGTGACTCTTGTCTTTCACAGTACAGCAGTA
GGAAGAGTGCAGAAAAGACGGATGTAACACAATGAACCGC
GTCGCGAACGACACGACGTAGCCTCGCCGTTTTTGTCTAG
AGTTGAAAACGCGCTTTCTTTTTCTTATGCCTTTGCTGAA
GGAATAACTCAAGTGTCGGTTCTCACGGGCGAACAGCGTG
TGTTTCTCAGAAGGATTTTAAAGGTTACTAATGGGGTCTC
AAGGGCCAGGACGGAAAAGAACCCCCAGCAAAAATGGGTT
GACTGCAGAGGAAGATGCCCTCAACGTAATCGCAAAAGAG
GCTGAAGCCCGTTTGGCAGCGAAGAGAGCGGCCCGTGCAG
AAGCTCGTGAGATCAGAATGAAAGAACTGGAGCGACAGCA
GAAAGAGGTGTCAGATGATGAAGAACGGATGTCAGTGGGG
AGCAGAAGCAACGTACGGGCTGATGACAGGTTAGAGCGTG
ACTACTTGGAAAAGGGCTCCTCACGAGCATCAACCATATC
TGGCACCACCCTCACCTCTCTGGGTGGGACGTCCTCACGG
AGAGGGAGTGGAGATACGTCCATCTCTGCCGACACAGAAG
CCTCCATACGGGAAATCAAGGATTCCCTATTGGAGGTTGA
GGAGAAGTACCGTAAGGCCATGGTGTCCAATGCACAGCTG
GACAATGAGAAGACCAACATGATGTATGAAGTGGACACTT
TAAGAGACTCTTTAATGGAACTGGAGGAGATGCTCTTTGA
AACTCGGCGTGAGCTGGAGGAAAAGATTAAGGATCTTGAA
AGAGAGAAGCATGCTCATAGTATACTGCAGTTTCAGTTCA
GTGAATTGAAGGAGACGCTGAAACAGAGTGAAGAACTGCT
GTCTAAACATGGCATTGTCCTTGGACCTGATTTAGTCACC
AATGGAGAAACGGGGGATGAAGTTGGAAATGCTGATCCGA
ATTCTCAAACAGCCTCAGCTGAAATTCGAGAGGGAAGTAG
TGTACTAGGCATTCATCAGTTGAAGCATAAAGACCAGGAA
CAAAAATATTTGGATGATGAGGTGCAAGGAAATCAGCAGT
CTTCAAATGCCCTATTCAGTTCTACTAACCCACCGTTAGA
GGCAAATGACAATGGTGTCCTTGGGGACTCTGTGGTTCCA
GGTGTAGGGCAGCATGAAAATAGAACTGAAGAACCTTTAA
GTTCTGTTGGTGATGAAGAAGTCACCGCTACAGCACCCAA
GGAGGAGGTCAAATCTGAGGAGCATGAACTGAAAGATTTG
AAAAATAATGCTGTGGAATTGAAGCGCAAAGTTTGTATGG
GTGAACATTTGGAGACCGAGCAACAAGAAAGCAAATGCGT
CAACTCAAGTCAGGAAATCAAAGAGGAAGCTCCTTTAGAT
TCTGTCTCTAATACAATGCATGATGAAACTGATAAACCTG
ATGAGGCAGTACTTGATGAACAATGCAAAGAGGAGCCTGT
GGAGTCATCTCAAATGGAGGAACCTCCTAAAACTCAAGTT
ACCAGTGCTTCAAATAAAAAGAAGAAAAAGAAGAAGAAGA
ACAAGCAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations