Transcript

lrrfip1a-005

ID
ZDB-TSCRIPT-110912-515
Name
lrrfip1a-005
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052027 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052027|OTTDARG00000029432|ZDB-GENE-030131-99 lrrfip1a|no_translation lrrfip1a-005 LG_none CR545476.14,CT867952.9 Danio rerio protein_coding KNOWN, 882 bp
AACACAATGAACCGCGTCGCGAACGACACGACGTAGCCTC
GCCGTTTTTGTCTAGAGTTGAAAACGCGCTTTCTTTTTCT
TATGCCTTTGCTGAAGGAATAACTCAAGTGTCGGTTCTCA
CGGGCGAACAGCGTGTGTTTCTCAGAAGGATTTTAAAGGT
TACTAATGGGGTCTCAAGGGCCAGGACGGAAAAGAACCCC
CAGCAAAAATGGGTTGACTGCAGAGGAAGATGCCCTCAAC
GTAATCGCAAAAGAGGCTGAAGCCCGTTTGGCAGCGAAGA
GAGCGGCCCGTGCAGAAGCTCGTGAGATCAGAATGAAAGA
ACTGGAGCGACAGCAGAAAGAGGTGAAGAAGCATCTCTGA
AACAGAATGTAGTTGGTCTTGGTTTTGTTTTAATTGAATT
ATTATATATGTTTTATTCAGGCAGTGTGCTATTAAAGTAG
CAAATGCATAACAAATCAAATCAACATCTCAAATAACGTC
TTAAATTATGTTTGAAATGTTTGTCTTTTTAACCCAAAAT
GATACATCTGATACCATATTAATATACAGCTGTGGAAAAA
AATAAGAGACCACTTGGACACTTAGTTTCTCTGCATTTAC
AAGTTTCAATTATGTGCTTCATTAAAAAGTAATTTTTTAG
TTCTGCCAGTTGATGTTGGCATTTCTTTAAAAGGTTGTCA
TTTTTAACATAAAAGTAAACAAAAAAGATGTCATTTTTTT
AGACATGTTCATGTTCATTTTAGACAGCATGTTCTGTTTT
AACTTCAGAGTTAAGAGATCAATATTTGGTTTGGTGCACT
TTTTGAGTTCAAACTAAAACATTTTGTATTTTGAACAATT
GTAATTTTATGGGAAAATGCTCTAAATGACAGTTTTATTA
TA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations